Dataset for CDS BCL2L1 of organism Stegastes partitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4Z3X2_BCL2L1-      ---------atgtctcaa---aacagagaactggtggtttactacataaa
A0A3B4Z3X2_BCL2L1-      ---------atgtctcaa---aacagagaactggtggtttactacataaa
A0A3B5B4X7_BCL2L1-      atggaaataatgtcgtacagtaacagagagctagtggagttctttataag
                                 *****  *    ******** ** ****  * **  **** 

A0A3B4Z3X2_BCL2L1-      gtataaactctcccagagaaactatcccctcaatcacatggtgctcaatg
A0A3B4Z3X2_BCL2L1-      gtataaactctcccagagaaactatcccctcaatcacatggtgctcaatg
A0A3B5B4X7_BCL2L1-      ctacaagctgtctcaaaggaactatccaacgtctctgctgaggccggagg
                         ** ** ** ** ** ** ********      **   **  **   * *

A0A3B4Z3X2_BCL2L1-      aggctcccaacaggactgacgggggggaggcgaggttggctg--aggaac
A0A3B4Z3X2_BCL2L1-      aggctcccaacaggactgacgggggggaggcgaggttggctg--aggaac
A0A3B5B4X7_BCL2L1-      atgctgcaggaaggactgagggagacaagaccaactctgctgccagtaac
                        * *** *    ******** ** *   ** * *  *  ****  ** ***

A0A3B4Z3X2_BCL2L1-      agcggacagagacacacgccaacgggacttttaatggcacgagtcccggg
A0A3B4Z3X2_BCL2L1-      agcggacagagacacacgccaacgggacttttaatggcacgagtcccggg
A0A3B5B4X7_BCL2L1-      ggcttgctgg--------------------tgaacagca-----------
                         **   * *                     * **  ***           

A0A3B4Z3X2_BCL2L1-      accccgccgccgtccccgcggcggttggcgtcgacggcgaccatggacgc
A0A3B4Z3X2_BCL2L1-      accccgccgccgtccccgcggcggttggcgtcgacggcgaccatggacgc
A0A3B5B4X7_BCL2L1-      -----------------gaggcgg-----------------catagaggc
                                         * *****                 *** ** **

A0A3B4Z3X2_BCL2L1-      ggtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacg
A0A3B4Z3X2_BCL2L1-      ggtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacg
A0A3B5B4X7_BCL2L1-      tgtaaaagcagcgcttaaggactcggcagatgagtttgaacttctcttca
                         ** ** *  ** **   **** ****  * ***** ** ** *  * * 

A0A3B4Z3X2_BCL2L1-      cccgcgccttcagcgacctgcacagccagctgcacatcacgccggccacc
A0A3B4Z3X2_BCL2L1-      cccgcgccttcagcgacctgcacagccagctgcacatcacgccggccacc
A0A3B5B4X7_BCL2L1-      cgcaagcttttagtgacctgtcttcacagcttgacatcactcctgacacg
                        * *  ** ** ** ******      *****  ******* ** * *** 

A0A3B4Z3X2_BCL2L1-      gcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgt
A0A3B4Z3X2_BCL2L1-      gcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgt
A0A3B5B4X7_BCL2L1-      gcctaccacagcttcaagagtgtgatggacgaggtgttcaaggatggggt
                        ******** ****** ***  ******************  *** ** **

A0A3B4Z3X2_BCL2L1-      caactggggccgcatcgtagggcttttcgcgttcggcggggcgctgtgtg
A0A3B4Z3X2_BCL2L1-      caactggggccgcatcgtagggcttttcgcgttcggcggggcgctgtgtg
A0A3B5B4X7_BCL2L1-      caactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtg
                        ********* ** ** ** ** ** **    ** ***** *  *******

A0A3B4Z3X2_BCL2L1-      tcgagtgcgtcgagaaggagatgagccccctggtgggccggatcgtagag
A0A3B4Z3X2_BCL2L1-      tcgagtgcgtcgagaaggagatgagccccctggtgggccggatcgtagag
A0A3B5B4X7_BCL2L1-      tggaatgcgtagacaagaatatgaacgagctggttccccgcatcgcagac
                        * ** ***** ** *** * **** *   *****   *** **** *** 

A0A3B4Z3X2_BCL2L1-      tggatgacggtttacctggacaaccacattcaggactggatccagagcca
A0A3B4Z3X2_BCL2L1-      tggatgacggtttacctggacaaccacattcaggactggatccagagcca
A0A3B5B4X7_BCL2L1-      tggatgaccatgtacctggatgagcacatcagtctgtggatccaaagcca
                        ********  * ********  * *****       ******** *****

A0A3B4Z3X2_BCL2L1-      aggcggatgggaccgcttcgctgaaatcttcggccaggacgcggcagccg
A0A3B4Z3X2_BCL2L1-      aggcggatgggaccgcttcgctgaaatcttcggccaggacgcggcagccg
A0A3B5B4X7_BCL2L1-      aggaggatgggagtgctttgctgaaattttcgggcaagacgccgccgcag
                        *** ********  **** ******** ***** ** ***** ** ** *

A0A3B4Z3X2_BCL2L1-      agagccggaggtctcaggagagcttcaagaagtggctgctggtggggatg
A0A3B4Z3X2_BCL2L1-      agagccggaggtctcaggagagcttcaagaagtggctgctggtggggatg
A0A3B5B4X7_BCL2L1-      aagcacggagatctcgggattctctgaagcgatggctgctagtcggaggg
                        *    ***** **** ***     * ***   ******** ** **   *

A0A3B4Z3X2_BCL2L1-      acggtggtgaccggggtcgtggtcggttcgctcatcgcccagaaacgcct
A0A3B4Z3X2_BCL2L1-      acggtggtgaccggggtcgtggtcggttcgctcatcgcccagaaacgcct
A0A3B5B4X7_BCL2L1-      gcgctgctaacgggagtgctggctggtgtgctcatcgctaagaaaca---
                         ** ** * ** ** **  ***  ***  *********  ******    

A0A3B4Z3X2_BCL2L1-      gtga
A0A3B4Z3X2_BCL2L1-      gtga
A0A3B5B4X7_BCL2L1-      gtga

© 1998-2023Legal notice