Dataset for CDS BCL2L2 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

13 sequence(s)

>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
agctggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccaggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatc
atgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgataccg
tgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=972 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=915 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
agctggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccaggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatc
atgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgataccg
tgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A287ATE4_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A3Q9B4M8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagatgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgccggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A482LX62_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=573 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactggggccgccttg
tggccttctttgtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcag
gagtggatggtga
>gnl|bcl2dbcds|A0A4D6NWN1_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagtcacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4X1SF63_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=1002 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4X1SF63_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
agctggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccaggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatc
atgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgataccg
tgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4X1SF63_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=999 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttat
catgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgatacc
gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctac
agatgcacttctttatttgccactgtttggcggaagtag
>gnl|bcl2dbcds|A0A4X1SF63_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=915 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
agctggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccaggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatc
atgtccattgaggagaagatggaggcagatgcccgatctatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagcacactttcatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagctcgataccg
tgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A4X1SF63_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Sus scrofa GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccagcagcgcttcacc
caggtctctgatgaactcttccaaggaggccccaactggggccgccttgtggccttctttgtcttcggagctgcactgtg
tgctgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2020Legal notice