Dataset for CDS BCL-2 of organism Cyclopterus lumpus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2X310_BCL2-06      atggc-----------gaacgagtgcaatcgcaac---------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaat
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-03      atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaat
A0A8C2X310_BCL2-05      atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaat
                                                                          

A0A8C2X310_BCL2-06      --attgtggaaaagtacatctgccataa---actctccaaacgg-----g
A0A8C2X310_BCL2-01      -------------------------------atgcttcttgtggtcgctg
A0A8C2X310_BCL2-02      caactcctggtggctccttctgccgtttgtcatgcttcttgtggtcgctg
A0A8C2X310_BCL2-04      -------------------------------atgcttcttgtggtcgctg
A0A8C2X310_BCL2-03      caactcctggtggctccttctgccgtttgtcatgcttcttgtggtcgctg
A0A8C2X310_BCL2-05      caactcctggtggctccttctgccgtttgtcatgcttcttgtggtcgctg
                                                       *  ** *    **     *

A0A8C2X310_BCL2-06      gctacgtgtttggatttgacgacgtccgagatgaagatgccgccgatgac
A0A8C2X310_BCL2-01      ccttcattgttgcatttg----tgttgctgttgtacatgatatcg----c
A0A8C2X310_BCL2-02      ccttcattgttgcatttg----tgttgctgttgtacatgatatcg----c
A0A8C2X310_BCL2-04      ccttcattgttgcatttg----tgttgctgttgtacatgatatcg----c
A0A8C2X310_BCL2-03      ccttcattgttgcatttg----tgttgctgttgtacatgatatcg----c
A0A8C2X310_BCL2-05      ccttcattgttgcatttg----tgttgctgttgtacatgatatcg----c
                         ** * *  *** *****     **    * ** * ***    **    *

A0A8C2X310_BCL2-06      ggcttaatagttgtcccgccgccgactctggtc--cgccggtgccgtga-
A0A8C2X310_BCL2-01      cacttattagtc-ccaaacctctgaaactgaacggggcccacgtcgtggt
A0A8C2X310_BCL2-02      cacttattagtc-ccaaacctctgaaactgaacggggcccacgtcgtggt
A0A8C2X310_BCL2-04      cacttattagtc-ccaaacctctgaaactgaacggggcccacgtcgtggt
A0A8C2X310_BCL2-03      cacttattagtc-ccaaacctctgaaactgaacggggcccacgtcgtggt
A0A8C2X310_BCL2-05      cacttattagtc-ccaaacctctgaaactgaacggggcccacgtcgtggt
                          **** ****   *   ** * **  ***  *   ***   * ****  

A0A8C2X310_BCL2-06      ------------atccggcaccgggcccgacatcg---------------
A0A8C2X310_BCL2-01      gactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
A0A8C2X310_BCL2-02      gactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
A0A8C2X310_BCL2-04      gactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
A0A8C2X310_BCL2-03      gactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
A0A8C2X310_BCL2-05      gactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
                                    *   ** * ****     *** *               

A0A8C2X310_BCL2-06      -----agagcgtcccccacctctg----------------caaacggctc
A0A8C2X310_BCL2-01      ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgctt
A0A8C2X310_BCL2-02      ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgctt
A0A8C2X310_BCL2-04      ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgctt
A0A8C2X310_BCL2-03      ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgctt
A0A8C2X310_BCL2-05      ggcaaggagcattcatcactttggtggcacgggatgaggtca--------
                              **** * *  *** *  *                 *        

A0A8C2X310_BCL2-06      c---------cgcagtccgacccgaccgccgccatccaccg--------g
A0A8C2X310_BCL2-01      caagcgaagaaagagttggagaaatttgccatcaatgacaaacaggt--g
A0A8C2X310_BCL2-02      caagcgaagaaagagttggagaaatttgccatcaatgacaaacaggt--g
A0A8C2X310_BCL2-04      caagcgaagaaagagttggagaaatttgccatcaatgacaaacaggt--g
A0A8C2X310_BCL2-03      caagcgaagaaagagttggagaaatttgccatcaatgacaaacaggtata
A0A8C2X310_BCL2-05      -------------------------------------------------a
                                                                          

A0A8C2X310_BCL2-06      gtcctgcgcgag-----------------------------gctgggga-
A0A8C2X310_BCL2-01      gtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaag
A0A8C2X310_BCL2-02      gtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaag
A0A8C2X310_BCL2-04      gtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaag
A0A8C2X310_BCL2-03      ttgctt---aaataattcagtgt------------tgacctactggagtg
A0A8C2X310_BCL2-05      ttgctt---aaataattcagtgt------------tgacctactggagtg
                         * **                                      ***    

A0A8C2X310_BCL2-06      -----------------cgaactcgagagactgtaccagccggacttcac
A0A8C2X310_BCL2-01      -------tgtgataaagcaggctcaggaga-------agctggggcctgt
A0A8C2X310_BCL2-02      -------tgtgataaagcaggctcaggaga-------agctggggcctgt
A0A8C2X310_BCL2-04      -------tgtgataaagcaggctcaggaga-------agctggggcctgt
A0A8C2X310_BCL2-03      gctttttttctgttgcgcaggctcaggaga-------agctggggcctgt
A0A8C2X310_BCL2-05      gctttttttctgttgcgcaggctcaggaga-------agctggggcctgt
                                         *   ***  ****       *** **       

A0A8C2X310_BCL2-06      ggagatgtcgcggcagctgtac-------ctcacctccacca----cggc
A0A8C2X310_BCL2-01      tgatatgttg-gtgaactgtgctggggtatccatttctggaaagtttgat
A0A8C2X310_BCL2-02      tgatatgttg-gtgaactgtgctggggtatccatttctggaaagtttgat
A0A8C2X310_BCL2-04      tgatatgttg-gtgaactgtgctggggtatccatttctggaaagtttgat
A0A8C2X310_BCL2-03      tgatatgttg-gtgaactgtgctggggtatccatttctggaaagtttgat
A0A8C2X310_BCL2-05      tgatatgttg-gtgaactgtgctggggtatccatttctggaaagtttgat
                         ** **** * *  * **** *         **  **    *     *  

A0A8C2X310_BCL2-06      gcagcggaggttcgccg--------aggtgatag----------------
A0A8C2X310_BCL2-01      gaaatggaagtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A8C2X310_BCL2-02      gaaatggaagtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A8C2X310_BCL2-04      gaaatggaagtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A8C2X310_BCL2-03      gaaatggaagtggaccgttttaaaaaactgatggaagtgaactacctggg
A0A8C2X310_BCL2-05      gaaatggaagtggaccgttttaaa--------------------------
                        * *  *** **   ***                                 

A0A8C2X310_BCL2-06      ---------------acgaactgtt-------ccgggacggggtgaa-ct
A0A8C2X310_BCL2-01      gagcgtttacccgacacgagccgtcataaccaccatgaaggagcgaagaa
A0A8C2X310_BCL2-02      gagcgtttacccgacacgagccgtcataaccaccatgaaggagcgaagaa
A0A8C2X310_BCL2-04      gagcgtttacccgacacgagccgtcataaccaccatgaaggagcgaagaa
A0A8C2X310_BCL2-03      gagcgtttacccgacacgagccgtcataaccaccatgaaggagcgaagaa
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      ggggccggatta---tcgcgttcttcga------------------gttc
A0A8C2X310_BCL2-01      ggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgttt
A0A8C2X310_BCL2-02      ggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgttt
A0A8C2X310_BCL2-04      ggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgttt
A0A8C2X310_BCL2-03      ggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgttt
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      gggggcacggtgtgcgc--------ggagtgcgccgccaagcaggagatg
A0A8C2X310_BCL2-01      ggatacaccgcctactccccgtccaagtttgccctgcgtggcttggcaga
A0A8C2X310_BCL2-02      ggatacaccgcctactccccgtccaagtttgccctgcgtggcttggcaga
A0A8C2X310_BCL2-04      ggatacaccgcctactccccgtccaagtttgccctgcgtggcttggcaga
A0A8C2X310_BCL2-03      ggatacaccgcctactccccgtccaagtttgccctgcgtggcttggcaga
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      acctc-gcaggtgg------------acaacatc----------------
A0A8C2X310_BCL2-01      atctctgcagatggagataaagccatacaatatctacgtgacggtggcct
A0A8C2X310_BCL2-02      atctctgcagatggagataaagccatacaatatctacgtgacggtggcct
A0A8C2X310_BCL2-04      atctctgcagatggagataaagccatacaatatctacgtgacggtggcct
A0A8C2X310_BCL2-03      atctctgcagatggagataaagccatacaatatctacgtgacggtggcct
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      --------------------------------gcggagtggatgacggag
A0A8C2X310_BCL2-01      acccccctgacactgacactccaggattggctgaggaaaacaagaccaag
A0A8C2X310_BCL2-02      acccccctgacactgacactccaggattggctgaggaaaacaagaccaag
A0A8C2X310_BCL2-04      acccccctgacactgacactccaggattggctgaggaaaacaagaccaag
A0A8C2X310_BCL2-03      acccccctgacactgacactccaggattggctgaggaaaacaagaccaag
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      tattt-------aaatggacctctgaa---------------caactgga
A0A8C2X310_BCL2-01      cctctggagaccaaattaatctctgaaacctcaggagtttgccaaccaga
A0A8C2X310_BCL2-02      cctctggagaccaaattaatctctgaaacctcaggagtttgccaaccaga
A0A8C2X310_BCL2-04      cctctggagaccaaattaatctctgaaacctcaggagtttgccaaccaga
A0A8C2X310_BCL2-03      cctctggagaccaaattaatctctgaaacctcaggagtttgccaaccaga
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      t-------acaagataacgg---gggatg---------------------
A0A8C2X310_BCL2-01      ccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaaca
A0A8C2X310_BCL2-02      ccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaaca
A0A8C2X310_BCL2-04      ccaagtggccaaaatcattgttcgcgatgca-------------------
A0A8C2X310_BCL2-03      ccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaaca
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      gctccgtgggacccgatggttacatgctatcagccctcacctgtggaatg
A0A8C2X310_BCL2-02      gctccgtgggacccgatggttacatgctatcagccctcacctgtggaatg
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-03      gctccgtgggacccgatggttacatgctatcagccctcacctgtggaatg
A0A8C2X310_BCL2-05      --------------------------------------------------
                                                                          

A0A8C2X310_BCL2-06      -----------------------------------ggatgcctttgtgga
A0A8C2X310_BCL2-01      tcacccgtcacctccatcacagagggtctccagcaggatgcctttgtgga
A0A8C2X310_BCL2-02      tcacccgtcacctccatcacagagggtctccagcagattgttaccatggg
A0A8C2X310_BCL2-04      ------------------------------------attgttaccatggg
A0A8C2X310_BCL2-03      tcacccgtcacctccatcacagagggtctccagcagattgttaccatggg
A0A8C2X310_BCL2-05      ------------------------------------attgttaccatggg
                                                              **      *** 

A0A8C2X310_BCL2-06      gctgtatgacagacagagggactccctcttcaattgctcctggccctcca
A0A8C2X310_BCL2-01      gctgtatgacagacagagggactccctcttcaattgctcctggccctcca
A0A8C2X310_BCL2-02      actgttt------cggaccatcgccctcttcta-----cctgggcagttt
A0A8C2X310_BCL2-04      actgttt------cggaccatcgccctcttcta-----cctgggcagttt
A0A8C2X310_BCL2-03      actgttt------cggaccatcgccctcttcta-----cctgggcagttt
A0A8C2X310_BCL2-05      actgttt------cggaccatcgccctcttcta-----cctgggcagttt
                         **** *      * **    * ******** *     ***** *     

A0A8C2X310_BCL2-06      ttaagacggtcttcggtctggctgcactcggggccgccagcctcaccatc
A0A8C2X310_BCL2-01      ttaagacggtcttcggtctggctgcactcggggccgccagcctcaccatc
A0A8C2X310_BCL2-02      tgacagcattgtgcggcgctgcatgattcagagggaacagtcaaa-----
A0A8C2X310_BCL2-04      tgacagcattgtgcggcgctgcatgattcagagggaacagtcaaa-----
A0A8C2X310_BCL2-03      tgacagcattgtgcggcgctgcatgattcagagggaacagtcaaa-----
A0A8C2X310_BCL2-05      tgacagcattgtgcggcgctgcatgattcagagggaacagtcaaa-----
                        * *   *  * * ***    **   * ** * *    *** *  *     

A0A8C2X310_BCL2-06      ggagcataccttactcagaagtga
A0A8C2X310_BCL2-01      ggagcataccttactcagaagtga
A0A8C2X310_BCL2-02      --agcagctgataagagggagtaa
A0A8C2X310_BCL2-04      --agcagctgataagagggagtaa
A0A8C2X310_BCL2-03      --agcagctgataagagggagtaa
A0A8C2X310_BCL2-05      --agcagctgataagagggagtaa
                          ****     **    * *** *

© 1998-2022Legal notice