Dataset for CDS BAX of Organism Cyanistes caeruleus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C0UCC0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyanistes caeruleus GN=BAX (length=492 residues).
gaggatcccagcgagacacagggcacagggaggacttggggtgttgccgagctgggtgagacccagcccagcagccctga
caccaaacgcctcagtgagtgcctgcggcgcatcggcgacgagctcgacagcaacatggagctgcagaggatgattgagc
aggtggggtgtgatgcccccaaaaagctgtttttccgtgtggccaaggagatgttcgccgatggcaccttcaactggggc
cgtgtggttgccctgttctactttgcgtgcaaactggtgctgaaggctctctgcaccaaggtcccggagctggtccagac
tatcctgcgctggaccatggagtatgtccaggaacacgtgctggcctggatccaggcccagggcggatgggaagggctct
tgtcccacttcgggacccccacctggcagaccatcaccatcttcgccgctggtgtcctcacggcctcgctgaccatctgg
aagatgtcgtag
>gnl|bcl2dbcds|A0A8C0UCC0_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cyanistes caeruleus GN=BAX (length=564 residues).
atgacactggtgggaaggacttgggctccaggtgggacacagggaaaggggatacacagagccacaggaggacacagtga
gtacccagagttctggggcagccctgacaccaaacgcctcagtgagtgcctgcggcgcatcggcgacgagctcgacagca
acatggagctgcagaggatgattgagcaggtggggtgtgatgcccccaaaaagctgtttttccgtgtggccaaggagatg
ttcgccgatggcaccttcaactggggccgtgtggttgccctgttctactttgcgtgcaaactggtgctgaaggctctctg
caccaaggtcccggagctggtccagactatcctgcgctggaccatggagtatgtccaggaacacgtgctggcctggatcc
aggcccagggcggatgggtgaggcccctaaccccccaattcctcaggggcccaagaagggctcttgtcccacttcgggac
ccccacctggcagaccatcaccatcttcgccgctggtgtcctcacggcctcgctgaccatctggaagatgtcgtagactc
tcgg
© 1998-2023Legal notice