Dataset for CDS BCL2L2 of organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A667I624_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctagtggcagact
A0A667I624_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggct----gcgggcg
                        ****** *  * **  * **  ***   ** ****  **    ** * * 

A0A667I624_BCL2L2-      ttgtaggctataagctgaggcagaagggttatgtttgtg-----------
A0A667I624_BCL2L2-      gtcggggctccgggccggggcggcggcgccat-cttgtgcccggggccgg
                         *   ****    ** * *** *  * *  **  *****           

A0A667I624_BCL2L2-      -gagcaggccctggggagggcccagcagctgacccactgcaccaagcca-
A0A667I624_BCL2L2-      tggggaggccggggagggggccc--cggggggcgcaggggactacgggaa
                         * * *****  ** * ******  * *  * * **  * ** * *  * 

A0A667I624_BCL2L2-      -tgcgtgcagctggaga----tgagtttga-gacccgcttccggcgcacc
A0A667I624_BCL2L2-      cggcctggagtctgaggaactggagcctgaggagctgctgctggagc---
                          ** ** **   ***      ***  *** ** * *** * ** **   

A0A667I624_BCL2L2-      ttctctgatttggcagcccagttgcatgtgacccctgggtcagcccagca
A0A667I624_BCL2L2-      ----ccgagccgg-agcccg---------------------agcccgaag
                            * **   ** *****                      *****    

A0A667I624_BCL2L2-      acgcttcacccaggtctctgatgaactcttccaagggggccccaactggg
A0A667I624_BCL2L2-      aggagccgccccggcccc------gcgcccccccgggagctccgg-----
                        * *   * *** ** * *       * *  **  *** ** **       

A0A667I624_BCL2L2-      gccgccttgtggccttctttgtctttggagccgcactgtgtgctgagagt
A0A667I624_BCL2L2-      ---gccctg-ggcc-----tggctcgggagcccc----cgggccagagg-
                           *** ** ****     ** **  ****** *     * **     * 

A0A667I624_BCL2L2-      gtcaacaaggagatggagccacttgtgggacaagtgcaagagtggatggt
A0A667I624_BCL2L2-      -------aggaggaggagcc------gggactggt-cgagggtg------
                               *****  ******      *****  ** * ** ***      

A0A667I624_BCL2L2-      ggcctacctggagacacggctggccgactggattcacagcagtgggggct
A0A667I624_BCL2L2-      -----acccggggg-acgg-----------------cgccattgaggacc
                             *** ** *  ****                 *  ** ** ** * 

A0A667I624_BCL2L2-      gggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagcc
A0A667I624_BCL2L2-      cggagctggaagcgatcaaagctcgagtcagggagatggaggaagaagcc

A0A667I624_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgag
A0A667I624_BCL2L2-      gagaagctaaaggagctacagaacgaggtagagaaacagatgaatatgag

A0A667I624_BCL2L2-      tccacctccaggcaatgctggcccagtgatcatgtccattgaagagaaga
A0A667I624_BCL2L2-      tccacctccaggcaatgctggcccagtgatcatgtccattgaagagaaga

A0A667I624_BCL2L2-      tggaggctgatgcccgttccatttatgttggcaatgtggactatggtgca
A0A667I624_BCL2L2-      tggaggctgatgcccgttccatttatgttggcaatgtggactatggtgca

A0A667I624_BCL2L2-      acagcagaagagctggaagcacactttcatggctgtggttcagtcaaccg
A0A667I624_BCL2L2-      acagcagaagagctggaagcacactttcatggctgtggttcagtcaaccg

A0A667I624_BCL2L2-      tgttaccatactttgtgacaaatttagtggccatcctaaagggtttgcat
A0A667I624_BCL2L2-      tgttaccatactttgtgacaaatttagtggccatcctaaagggtttgcat

A0A667I624_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccttggccttagat
A0A667I624_BCL2L2-      atatagagttctcagacaaagagtcagtgaggacttccttggccttagat

A0A667I624_BCL2L2-      gagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaaccaa
A0A667I624_BCL2L2-      gagtccctatttagaggaagacaaatcaaggtgatcccaaaacgaaccaa

A0A667I624_BCL2L2-      cagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc
A0A667I624_BCL2L2-      cagaccaggcatcagcacaacagaccggggtttcccacgagcccgatacc

A0A667I624_BCL2L2-      gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggt
A0A667I624_BCL2L2-      gtgcccggaccaccaactacaacagttcccgctctcgattctacagtggt

A0A667I624_BCL2L2-      tttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgac
A0A667I624_BCL2L2-      tttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgac

A0A667I624_BCL2L2-      atcatggtattccccttactaa
A0A667I624_BCL2L2-      atcatggtattccccttactaa

© 1998-2021Legal notice