Dataset for CDS BCL-2 of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      atgcagactgctttgtcacggggagaaagggttcaacacggtactttaat
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ccgactgttgcacatctttgactctctgccaaaccagcgaacaactcctc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ctccgacgtccgtgtttcgccaccccctttcagggccatcgccagcctcg
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      tatctcggttatcgaacccctgaagctggcctgctagttagcagacgagc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      ----------------------atgtcctctgaagaagggttgagctcaa
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      taacgattgtcagatttcacccatgtcctctgaagaagggttgagctcaa
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      cgatcacagattggcttttcatcaactcctggtggctccttctgccattc
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      cgatcacagattggcttttcatcaactcctggtggctccttctgccattc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      ---atg------gcgaacg--------agtgtaatcgcaatattgtagaa
A0A7N6A4C8_BCL2-02      ---atgcttcttgtaattgctgccttcattgttgcctttgtgttgctg--
A0A7N6A4C8_BCL2-04      ---atgcttcttgtaattgctgccttcattgttgcctttgtgttgctg--
A0A7N6A4C8_BCL2-07      attatgcttcttgtaattgctgccttcattgttgcctttgtgttgctg--
A0A7N6A4C8_BCL2-05      ---atgcttcttgtaattgctgccttcattgttgcctttgtgttgctg--
A0A7N6A4C8_BCL2-03      attatgcttcttgtaattgctgccttcattgttgcctttgtgttgctg--
A0A7N6A4C8_BCL2-06      ---atgcttcttgtaattgctgccttcattgttgcctttgtgttgctg--
                           ***      *  *  *        * ***   *    * ***  *  

A0A7N6A4C8_BCL2-01      aagtatatctgccataaactct----------------------ccaaac
A0A7N6A4C8_BCL2-02      --ttatacatgatatcacctcttattagtcccaaacctctgaaactgaac
A0A7N6A4C8_BCL2-04      --ttatacatgatatcacctcttattagtcccaaacctctgaaactgaac
A0A7N6A4C8_BCL2-07      --ttatacatgatatcacctcttattagtcccaaacctctgaaactgaac
A0A7N6A4C8_BCL2-05      --ttatacatgatatcacctcttattagtcccaaacctctgaaactgaac
A0A7N6A4C8_BCL2-03      --ttatacatgatatcacctcttattagtcccaaacctctgaaactgaac
A0A7N6A4C8_BCL2-06      --ttatacatgatatcacctcttattagtcccaaacctctgaaactgaac
                           ****  **  ** * ****                      *  ***

A0A7N6A4C8_BCL2-01      ggggctacgcgtgggggtttcatgatgcccaagacgaa------------
A0A7N6A4C8_BCL2-02      ggggcc-cacgtcgtggtgacgggaggctctagtgggattgggaagtgca
A0A7N6A4C8_BCL2-04      ggggcc-cacgtcgtggtgacgggaggctctagtgggattgggaagtgca
A0A7N6A4C8_BCL2-07      ggggcc-cacgtcgtggtgacgggaggctctagtgggattgggaagtgca
A0A7N6A4C8_BCL2-05      ggggcc-cacgtcgtggtgacgggaggctctagtgggattgggaagtgca
A0A7N6A4C8_BCL2-03      ggggcc-cacgtcgtggtgacgggaggctctagtgggattgggaagtgca
A0A7N6A4C8_BCL2-06      ggggcc-cacgtcgtggtgacgggaggctctagtgggattgggaagtgca
                        *****  * *** * ***  *  ** ** * **  * *            

A0A7N6A4C8_BCL2-01      ---------gatgctgctaataatgggtctgcagttccccct--------
A0A7N6A4C8_BCL2-02      ttgcaattgaatgctacagacaaggagcattca--tcactttagtggcac
A0A7N6A4C8_BCL2-04      ttgcaattgaatgctacagacaaggagcattca--tcactttagtggcac
A0A7N6A4C8_BCL2-07      ttgcaattgaatgctacagacaaggagcattca--tcactttagtggcac
A0A7N6A4C8_BCL2-05      ttgcaattgaatgctacagacaaggagcattca--tcactttagtggcac
A0A7N6A4C8_BCL2-03      ttgcaattgaatgctacagacaaggagcattca--tcactttagtggcac
A0A7N6A4C8_BCL2-06      ttgcaattgaatgctacagacaaggagcattca--tcactttagtggcac
                                  ***** *  * ** * *  * **  ** *  *        

A0A7N6A4C8_BCL2-01      ------------------------------------------------cc
A0A7N6A4C8_BCL2-02      gaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
A0A7N6A4C8_BCL2-04      gaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
A0A7N6A4C8_BCL2-07      gaaatg--------------------------------------------
A0A7N6A4C8_BCL2-05      gaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
A0A7N6A4C8_BCL2-03      gaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
A0A7N6A4C8_BCL2-06      gaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
                                                                          

A0A7N6A4C8_BCL2-01      accgactttggtccggcggtgccgtgaa-gccagca-------ccgggcc
A0A7N6A4C8_BCL2-02      atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtga
A0A7N6A4C8_BCL2-04      atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtga
A0A7N6A4C8_BCL2-07      -------------aggtggtgctttgcatatcagtggatgtttccagtga
A0A7N6A4C8_BCL2-05      atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtga
A0A7N6A4C8_BCL2-03      atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtga
A0A7N6A4C8_BCL2-06      atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtga
                                      ** *****  ** *   ***         ** *   

A0A7N6A4C8_BCL2-01      tgacagc------gacagcatcccgcaaca-------ctgcagacggctc
A0A7N6A4C8_BCL2-02      ttatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgggac
A0A7N6A4C8_BCL2-04      ttatagtcaggtggaaagtgtgataaaaca--------------------
A0A7N6A4C8_BCL2-07      ttatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgggac
A0A7N6A4C8_BCL2-05      ttatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgggac
A0A7N6A4C8_BCL2-03      ttatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgggac
A0A7N6A4C8_BCL2-06      ttatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgggac
                        * * **       ** **  *     ****                    

A0A7N6A4C8_BCL2-01      cctccgtccgacccgcacgctgcgctcca----cagggtcc------tgc
A0A7N6A4C8_BCL2-02      ctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagttt
A0A7N6A4C8_BCL2-04      ----------------gcactttactccagattccactattgcaaaat--
A0A7N6A4C8_BCL2-07      ctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagttt
A0A7N6A4C8_BCL2-05      ctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagttt
A0A7N6A4C8_BCL2-03      ctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagttt
A0A7N6A4C8_BCL2-06      ctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagttt
                                           **   **  *    *             *  

A0A7N6A4C8_BCL2-01      gtgaggctggagatga--------acttgaaagactatatcagccggact
A0A7N6A4C8_BCL2-02      gaggaggtggaggtgg----attgttttaaaaaactgatggaagtgaact
A0A7N6A4C8_BCL2-04      -----------gttggccttattttcaccagaaactgatggaagtgaact
A0A7N6A4C8_BCL2-07      gaggaggtggaggtgg----attgttttaaa-------------------
A0A7N6A4C8_BCL2-05      gaggaggtggaggtgg----attgttttaaaaaactgatggaagtgaact
A0A7N6A4C8_BCL2-03      gaggaggtggaggtgg----attgttttaaaaaactgatggaagtgaact
A0A7N6A4C8_BCL2-06      gaggaggtggaggtgg----attgttttaaa-------------------
                                   * **              *                    

A0A7N6A4C8_BCL2-01      tcacggaga---tgtcccgacagctgtatctcacctccaccacggcgcag
A0A7N6A4C8_BCL2-02      acctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggag
A0A7N6A4C8_BCL2-04      acctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggag
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      acctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggag
A0A7N6A4C8_BCL2-03      acctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggag
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      cggagattcgccgaggtgatagacgaactgttc----cgggacggggtga
A0A7N6A4C8_BCL2-02      cgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttgg
A0A7N6A4C8_BCL2-04      cgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttgg
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      cgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttgg
A0A7N6A4C8_BCL2-03      cgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttgg
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      actg--gggccggattatcgctttc---ttcgagttcgg-----------
A0A7N6A4C8_BCL2-02      cctgtttggatacactgcctactccccatccaagtttgccctgcgtggtt
A0A7N6A4C8_BCL2-04      cctgtttggatacactgcctactccccatccaagtttgccctgcgtggtt
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      cctgtttggatacactgcctactccccatccaagtttgccctgcgtggtt
A0A7N6A4C8_BCL2-03      cctgtttggatacactgcctactccccatccaagtttgccctgcgtggtt
A0A7N6A4C8_BCL2-06      --------------------------------------------------
                                                                          

A0A7N6A4C8_BCL2-01      -------------------------------cggcaccgtgtgcgtgg-a
A0A7N6A4C8_BCL2-02      tagcagagtcactgcagatggagataaagccctacaatatatatgtgaca
A0A7N6A4C8_BCL2-04      tagcagagtcactgcagatggagataaagccctacaatatatatgtgaca
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      tagcagagtcactgcagatggagataaagccctacaatatatatgtgaca
A0A7N6A4C8_BCL2-03      tagcagagtcactgcagatggagataaagccctacaatatatatgtgaca
A0A7N6A4C8_BCL2-06      -----------------------ataaagccctacaatatatatgtgaca
                                                                          

A0A7N6A4C8_BCL2-01      gtgcgcgtccaaggaggagatgacaccgcaggt--------gaacaacat
A0A7N6A4C8_BCL2-02      gtggcctacccccccgacactgacactccaggtttggctgaggaaaataa
A0A7N6A4C8_BCL2-04      gtggcctacccccccgacactgacactccaggtttggctgaggaaaataa
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      gtggcctacccccccgacactgacactccaggtttggctgaggaaaataa
A0A7N6A4C8_BCL2-03      gtggcctacccccccgacactgacactccaggtttggctgaggaaaataa
A0A7N6A4C8_BCL2-06      gtggcctacccccccgacactgacactccaggtttggctgaggaaaataa
                                                                          

A0A7N6A4C8_BCL2-01      cgcagagtggatgacggagtatttaaatggacctctt-cacagctgga--
A0A7N6A4C8_BCL2-02      gacaaagcctctggaga-----ccaaattaatctctgaaacatctggagt
A0A7N6A4C8_BCL2-04      gacaaagcctctggaga-----ccaaattaatctctgaaacatctggagt
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      gacaaagcctctggaga-----ccaaattaatctctgaaacatctggagt
A0A7N6A4C8_BCL2-03      gacaaagcctctggaga-----ccaaattaatctctgaaacatctggagt
A0A7N6A4C8_BCL2-06      gacaaagcctctggaga-----ccaaattaatctctgaaacatctggagt
                                                                          

A0A7N6A4C8_BCL2-01      --------------------------------tacaagata----acggg
A0A7N6A4C8_BCL2-02      ctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcagg
A0A7N6A4C8_BCL2-04      ctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcagg
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      ctgtcaaccagaccaagtggccaaaatcattgtgcgagatgca-------
A0A7N6A4C8_BCL2-03      ctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcagg
A0A7N6A4C8_BCL2-06      ctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcagg
                                                                          

A0A7N6A4C8_BCL2-01      gga-----------------------------------------------
A0A7N6A4C8_BCL2-02      ggaacttcaatagctcagtgggacctgatggttacatgctctctgccctc
A0A7N6A4C8_BCL2-04      ggaacttcaatagctcagtgggacctgatggttacatgctctctgccctc
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ggaacttcaatagctcagtgggacctgatggttacatgctctctgccctc
A0A7N6A4C8_BCL2-06      ggaacttcaatagctcagtgggacctgatggttacatgctctctgccctc
                                                                          

A0A7N6A4C8_BCL2-01      -----tgggatgcc------------------------------------
A0A7N6A4C8_BCL2-02      acctgtggaatgtcacccgttacctccattacagagggtctccagcagga
A0A7N6A4C8_BCL2-04      acctgtggaatgtcacccgttacctccattacagagggtctccagcagat
A0A7N6A4C8_BCL2-07      ------------------------------------------------at
A0A7N6A4C8_BCL2-05      ------------------------------------------------at
A0A7N6A4C8_BCL2-03      acctgtggaatgtcacccgttacctccattacagagggtctccagcagat
A0A7N6A4C8_BCL2-06      acctgtggaatgtcacccgttacctccattacagagggtctccagcagat
                                                                          

A0A7N6A4C8_BCL2-01      ----ttcgtggacctgtatgacagacagagggagtctgtgttcagttgct
A0A7N6A4C8_BCL2-02      tgccttcgtggacctgtatgacagacagagggagtctgtgttcagttgct
A0A7N6A4C8_BCL2-04      aattaccatgggattattt-----------cgaaccattgccctgttcta
A0A7N6A4C8_BCL2-07      aattaccatgggattattt-----------cgaaccattgccctgttcta
A0A7N6A4C8_BCL2-05      aattaccatgggattattt-----------cgaaccattgccctgttcta
A0A7N6A4C8_BCL2-03      aattaccatgggattattt-----------cgaaccattgccctgttcta
A0A7N6A4C8_BCL2-06      aattaccatgggattattt-----------cgaaccattgccctgttcta
                              * ***   * * *            **  *  **  * ***   

A0A7N6A4C8_BCL2-01      cctg----gtcctccatcaagacggtcttcggcctcgctgc---tctcgg
A0A7N6A4C8_BCL2-02      cctg----gtcctccatcaagacggtcttcggcctcgctgc---tctcgg
A0A7N6A4C8_BCL2-04      cttggggagtttt-------gacagcatcgtacgccgctgcatgattcaa
A0A7N6A4C8_BCL2-07      cttggggagtttt-------gacagcatcgtacgccgctgcatgattcaa
A0A7N6A4C8_BCL2-05      cttggggagtttt-------gacagcatcgtacgccgctgcatgattcaa
A0A7N6A4C8_BCL2-03      cttggggagtttt-------gacagcatcgtacgccgctgcatgattcaa
A0A7N6A4C8_BCL2-06      cttggggagtttt-------gacagcatcgtacgccgctgcatgattcaa
                        * **    **  *       *** *  *    *  ******     **  

A0A7N6A4C8_BCL2-01      ggcagccagcctcaccattggagcttaccttgcacagaaatga
A0A7N6A4C8_BCL2-02      ggcagccagcctcaccattggagcttaccttgcacagaaatga
A0A7N6A4C8_BCL2-04      agagagcagtcaaaa----gcagctgacaagagagagtaa---
A0A7N6A4C8_BCL2-07      agagagcagtcaaaa----gcagctgacaagagagagtaa---
A0A7N6A4C8_BCL2-05      agagagcagtcaaaa----gcagctgacaagagagagtaa---
A0A7N6A4C8_BCL2-03      agagagcagtcaaaa----gcagctgacaagagagagtaa---
A0A7N6A4C8_BCL2-06      agagagcagtcaaaa----gcagctgacaagagagagtaa---
                         *    *** *  *     * **** **     * ** **   

© 1998-2022Legal notice