Dataset for CDS BOK of Organism Lepisosteus oculatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W5MH97_BOK-01      ctggaggggatggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtg
W5MH97_BOK-02      ---------atggaggtgctgcgcaggtcttcggtgtttgctgctgaagtaatggaggtg

W5MH97_BOK-01      tttgaccgctcccccacggacaaggagctggtctcccaggccaaggcgctctgcagggaa
W5MH97_BOK-02      tttgaccgctcccccacggacaaggagctggtctcccaggccaaggcgctctgcagggaa

W5MH97_BOK-01      tacatccactcccggctgaaccgagcgggactaggctggtccaaaccagagcatgcggcc
W5MH97_BOK-02      tacatccactcccggctgaaccgagcgggactaggctggtccaaaccagagcatgcggcc

W5MH97_BOK-01      cacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgaccc
W5MH97_BOK-02      cacggggaggtgtcctccgtcctgctgtggctcggcgatgagctggaatacctgcgaccc

W5MH97_BOK-01      aacatttaccggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtg
W5MH97_BOK-02      aacatttaccggaatgtggcgagacaactcagcatcactgtggcctcggagaacattgtg

W5MH97_BOK-01      tcagatgccttcctggccgtagctgcagagatcttcagcactgaaattgccaagaaagca
W5MH97_BOK-02      tcagatgccttcctggccgtagctgcagagatcttcagcactg-----------------

W5MH97_BOK-01      gcagtaaaggggaagtgtataacgtgggggaaggtggtatctctgtacgcagtggctgga
W5MH97_BOK-02      ----------------gtataacgtgggggaaggtggtatctctgtacgcagtggctgga

W5MH97_BOK-01      ggtctggcggtggactgcgtgcgtcatggacacccagccatggtcgataccattgtggac
W5MH97_BOK-02      ggtctggcggtggactgcgtgcgtcatggacacccagccatggtcgataccattgtggac

W5MH97_BOK-01      tgcctgggcgagtttgtgcgcaagagcctggtcgaatggctgaggagaaggggtggatgg
W5MH97_BOK-02      tgcctgggcgagtttgtgcgcaagagcctggtcgaatggctgaggagaaggggtggatgg

W5MH97_BOK-01      gctgacgtcacaaagtgtgtagtgaacactgacccccgtctccggtctcactggctaatc
W5MH97_BOK-02      gctgacgtcacaaagtgtgtagtgaacactgacccccgtctccggtctcactggctaatc

W5MH97_BOK-01      tctgctgcctgtacctgtggtcacttcgtcaaaaccgtggtcttctaccttctgcgagag
W5MH97_BOK-02      tctgctgcctgtacctgtggtcacttcgtcaaaaccgtggtcttctaccttctgcgagag

W5MH97_BOK-01      cgctga
W5MH97_BOK-02      cgctga

© 1998-2023Legal notice