Dataset for CDS BCL-2-like of organism Myripristis murdjan

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A667YZT5_MCL1-01      atgaacatcgtttcgaagcgggcaaccattggagcaattggaagttgttt
A0A667YZT5_MCL1-02      atgaacatcgtttcgaagcgggcaaccattggagcaattggaagttgttt
A0A667Y1V0_BCL2L1-      atg----tcatacagtaacagagaact---------------ggtggttt
A0A667ZHE8_BCL2L1-      atg----tc---ccaaaacagagaact---------------ggtggttt
                        ***    **       * * *  ***                 ** ****

A0A667YZT5_MCL1-01      tatttttcctcaaaatggagtcgtcgagggacaaatgtactacggctctg
A0A667YZT5_MCL1-02      tatttttcctcaaaatggagtcgtcgagggacaaatgtactacggctctg
A0A667Y1V0_BCL2L1-      tctttataaactataaactgtctcagaggaac------------------
A0A667ZHE8_BCL2L1-      tctacataacctataaactctcccagaggaac------------------
                        * *   *   * * *     **   **** **                  

A0A667YZT5_MCL1-01      gagattcctcccctcagatagcaatggcctccaccctggaaaacgggaat
A0A667YZT5_MCL1-02      gagattcctcccctcagatagcaatggcctccaccctggaaaacgggaat
A0A667Y1V0_BCL2L1-      --tatcccacttgtcagctggggctggaggaggccagcgaaa---ggact
A0A667ZHE8_BCL2L1-      --tatcctttcaaccacatcgggctcatagagtccccaaaca---ggact
                           ** *       **  * *   *        **    * *   *** *

A0A667YZT5_MCL1-01      gccgtctccagcgacacgccgaagcggccgaaaaacctaggagttaacgg
A0A667YZT5_MCL1-02      gccgtctccagcgacacgccgaagcggccgaaaaacctaggagttaacgg
A0A667Y1V0_BCL2L1-      gagg-----gagacgacgccgacgc-------------------------
A0A667ZHE8_BCL2L1-      gatg-----gggggcaggcaggggcggccgaggaacagcgg---------
                        *  *           * ** *  **                         

A0A667YZT5_MCL1-01      gtttacagcgaaaaa--cagccgggacgatagcaccgacaacgacgacgg
A0A667YZT5_MCL1-02      gtttacagcgaaaaa--cagccgggacgatagcaccgacaacgacgacgg
A0A667Y1V0_BCL2L1-      --------cgtcatct-ctaatggctcactggc--------caacagcag
A0A667ZHE8_BCL2L1-      ----gtagcgacacatgccaacgggacact-----------caacggcac
                                **  *    *    **  *  *           * **  *  

A0A667YZT5_MCL1-01      gtctttgccgtgcacgccggagctgcagt--cggacagcgaggccgacgt
A0A667YZT5_MCL1-02      gtctttgccgtgcacgccggagctgcagt--cggacagcgaggccgacgt
A0A667Y1V0_BCL2L1-      ga--ccgg------cgccggc----------cagccggggacgccgtcgc
A0A667ZHE8_BCL2L1-      gagtccgggcaccccgccggcatcgcccttgcggcgggagcggtcggcgt
                        *     *       ******           * *   * *  * ** ** 

A0A667YZT5_MCL1-01      gtccggcagcccggcgggggaggcggtggtggacaatgacacaaggcatc
A0A667YZT5_MCL1-02      gtccggcagcccggcgggggaggcggtggtggacaatgacacaaggcatc
A0A667Y1V0_BCL2L1-      ctcc----gtacggcg-gcatagaggtcgttaaggctgcgcttcaggaat
A0A667ZHE8_BCL2L1-      c--------cacgacgagcctggacgcggtgaaggaggccctgcgggact
                                   ** ** *    *  *  **  *    *       * *  

A0A667YZT5_MCL1-01      tggtggagactttcttaagagactata-gtgggctttc--caggccgcgg
A0A667YZT5_MCL1-02      tggtggagactttcttaagagactata-gtgggctttc--caggccgcgg
A0A667Y1V0_BCL2L1-      cggcggatgagtttgaactgcgctacacgcaggcgttcagcagcctctcc
A0A667ZHE8_BCL2L1-      cggccaacgagttcgagctgcgttacgcccgcgccttcaacgacttgcac
                         **   *    **          **       ** ***  *         

A0A667YZT5_MCL1-01      tggagggaggacaaggcactagaaaccatgaaaagagtcgtggaggatgt
A0A667YZT5_MCL1-02      tggagggaggacaaggcactagaaaccatgaaaagagtcgtggaggatgt
A0A667Y1V0_BCL2L1-      tcccagctccacatcacccccg---ccaca--------------------
A0A667ZHE8_BCL2L1-      gaccagctgcacatcacgccgg---ccacg--------------------
                             *    ***   * *  *   ***                      

A0A667YZT5_MCL1-01      tcttgagaaacaccgatacgcttacaatggtatggtgaggaaagtcgcgc
A0A667YZT5_MCL1-02      tcttgagaaacaccgatacgcttacaatggtatggtgaggaaagtcgcgc
A0A667Y1V0_BCL2L1-      -------------------gcctaccacagctttgagag------cgtaa
A0A667ZHE8_BCL2L1-      -------------------gcctaccagagcttcgagag------cgtga
                                           ** *** *  *  * * ***      **   

A0A667YZT5_MCL1-01      tggacgagaggggagacgacatgagtttcgtcacgtccgtggccaagagc
A0A667YZT5_MCL1-02      tggacgagaggggagacgacatgagtttcgtcacgtccgtggccaagagc
A0A667Y1V0_BCL2L1-      tggacgaggtg---------------------------------------
A0A667ZHE8_BCL2L1-      tggatgaggtg---------------------------------------
                        **** ***  *                                       

A0A667YZT5_MCL1-01      ctcttcggggacggaaccaccaactgggggcgcatcgccagcctggtggc
A0A667YZT5_MCL1-02      ctcttcggggacggaaccaccaactgggggcgcatcgccagcctggtggc
A0A667Y1V0_BCL2L1-      ---tttcggaacgg---agtcaactgggggcgggtggtgggcctgtttgc
A0A667ZHE8_BCL2L1-      ---ttccgggacgg---cgtcaactggggacgcgtggtcgggctgttcgc
                           **  ** ****      ********* **  * *   * *** * **

A0A667YZT5_MCL1-01      cttcggggccg--ttgtgtgtcagcacctacgggaaaaagg---------
A0A667YZT5_MCL1-02      cttcggggccg--ttgtgtgtcagcacctacgggaaaaagg---------
A0A667Y1V0_BCL2L1-      cttcgggggcgccctctgtgtgga---gtgtgtggagagggatatgaacc
A0A667ZHE8_BCL2L1-      gttcggcggcgcgctgtgcgtcga---gtgcgtggagaaggagatgagtc
                         ***** * **   * ** **       *  * * * * **         

A0A667YZT5_MCL1-01      ---------cagggatcactgcgtgagct-cagtgagccgagaaatctct
A0A667YZT5_MCL1-02      ---------cagggatcactgcgtgagct-cagtgagccgagaaatctct
A0A667Y1V0_BCL2L1-      agctggtgccccgcattgcagactggatgaccacgtaccttgataac---
A0A667ZHE8_BCL2L1-      cgctggtgtcaaggatcgccgagtggatgacagtctacctggacaac---
                                 *  * **  * *  **     *      **  ** * *   

A0A667YZT5_MCL1-01      acatacctgctgtcggatcaacgggagtggctgatcaggaacaattcatg
A0A667YZT5_MCL1-02      acatacctgctgtcggatcaacgggagtggctgatcaggaacaattcatg
A0A667Y1V0_BCL2L1-      -cacattgagccatggatccagagggaagg------agg--------ctg
A0A667ZHE8_BCL2L1-      -cacatccagccctggatccacagccaagg------agg--------atg
                         ** *         ***** *  *    **      ***         **

A0A667YZT5_MCL1-01      ggatggttttgtggagttctttcgagtagcagacccagaatccacggtga
A0A667YZT5_MCL1-02      ggatggttttgtggagttctttcgagtagcagacccagaatccacggtga
A0A667Y1V0_BCL2L1-      ggaccgcttcgctgagatt-tacgggcga--gacgccgctgcagaggcga
A0A667ZHE8_BCL2L1-      ggaacgctttgccgagatc-tacgggcag--gacgcggcggcagagggca
                        ***  * ** *  *** *  * ** *     *** * *   *   **  *

A0A667YZT5_MCL1-01      ggaacacactcatggcctt-----------tgctggatttgctgg-----
A0A667YZT5_MCL1-02      ggaacacactcatggcctt-----------tgctggatttgctgg-----
A0A667Y1V0_BCL2L1-      ggagagctcaggagagtctaaggagatggctgctggttggcgtggtgctg
A0A667ZHE8_BCL2L1-      ggagggctcaggagagcttcaggaagtggctgctggccgggatgaccctg
                        ***   * *    *    *           ******      **      

A0A667YZT5_MCL1-01      --catcggggcaacgctggccctgctgatca---------gg---tga
A0A667YZT5_MCL1-02      --catcggggcaacgctggccctgctgatca---------ggttctga
A0A667Y1V0_BCL2L1-      ctcacaggcgtgctgctcggcgctctcatcgcaaagaaacatccctga
A0A667ZHE8_BCL2L1-      gtcaccggagtcgtcgtggggtcgcttatcgcccagaagcgcctgtga
                          **  ** *      * *     ** ***               ***

© 1998-2020Legal notice