Dataset for CDS BCL2L1 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2H0F6_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A3Q2H0F6_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct

A0A3Q2H0F6_BCL2L1-      ttcccagaaaggatacaactggagtcagtttagtgacgtggaagagaaca
A0A3Q2H0F6_BCL2L1-      ttcccagaaaggatacaactggagtcagtttagtgacgtggaagagaaca

A0A3Q2H0F6_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
A0A3Q2H0F6_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc

A0A3Q2H0F6_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccacggggaatgg
A0A3Q2H0F6_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccacggggaatgg

A0A3Q2H0F6_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaagtgatccccatgg
A0A3Q2H0F6_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaagtgatccccatgg

A0A3Q2H0F6_BCL2L1-      cagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgagg
A0A3Q2H0F6_BCL2L1-      cagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgagg

A0A3Q2H0F6_BCL2L1-      taccggcgggcattcagcgacctgacatcccagctccacatcaccccagg
A0A3Q2H0F6_BCL2L1-      taccggcgggcattcagcgacctgacatcccagctccacatcaccccagg

A0A3Q2H0F6_BCL2L1-      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
A0A3Q2H0F6_BCL2L1-      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg

A0A3Q2H0F6_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A3Q2H0F6_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg

A0A3Q2H0F6_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A3Q2H0F6_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc

A0A3Q2H0F6_BCL2L1-      aacctggatggccacttacctgaatgaccacctagagccttggatccaag
A0A3Q2H0F6_BCL2L1-      aacctggatggccacttacctgaatgaccacctagagccttggatccaag

A0A3Q2H0F6_BCL2L1-      agaacggcggctgg---gacacctttgtggaactctacgggaacaacgcg
A0A3Q2H0F6_BCL2L1-      agaacggcggctggaaagaaactgctttggggaccttctgctacttcgtt
                        **************   ** **   * ***    ** * *  **  **  

A0A3Q2H0F6_BCL2L1-      gcagcc-----gaaagccggaagggcca----ggagc----------gct
A0A3Q2H0F6_BCL2L1-      tcatccctgatgagactctca--ggccaaggcggagccttacagctagct
                         ** **     ** *  *  *  *****    *****          ***

A0A3Q2H0F6_BCL2L1-      tcaaccgctggttcctgacgggcatgactgtgg-------ctggt-----
A0A3Q2H0F6_BCL2L1-      ccaagctacagtgctttttgggca-gactccagagctcccctcggaacta
                         *** *    ** * *   ***** ****   *       ** *      

A0A3Q2H0F6_BCL2L1-      gtggttctgctgggctcactcttcagt--------cggaagtga
A0A3Q2H0F6_BCL2L1-      gaggtttttct---ctcgctcttcaggaaatgccattgcaatga
                        * **** * **   *** ********           * * ***

© 1998-2021Legal notice