Dataset for CDS BCL-2-like of organism Poecilia mexicana

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3YT99_BCL2L10      atg--------------caccgag-------------gttct--------
A0A3B3YCD0_MCL1-01      atgacggctaattcgacaaccgcgttaaactatctaattttttctcaaaa
A0A3B3WI27_BCL2L1-      atg-----tcac---gaaacagag---aactggtgcttttct--------
A0A3B3XN57_BCL2L1-      atg-----tcctacagcaacagag---aactggtggagttct--------
                        ***               ** * *              ** *        

A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3B3YCD0_MCL1-01      tggagtcggggatggacaaacacactacgaccaggggctcgttgtgcctg
A0A3B3WI27_BCL2L1-      ---------------------acatta-----------------------
A0A3B3XN57_BCL2L1-      ---------------------acataa-----------------------

A0A3B3YT99_BCL2L10      ------------------ccttccgccgtctggatgtg-cagag------
A0A3B3YCD0_MCL1-01      aagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccc
A0A3B3WI27_BCL2L1-      -----------------agtttaaactgtct--------cagaggaacta
A0A3B3XN57_BCL2L1-      -----------------gctacaaattgtct--------cagagaaacta
                                                    ***        *  **      

A0A3B3YT99_BCL2L10      ----agccgtcacatatcgctgggag-----------gaaaatgtcctgt
A0A3B3YCD0_MCL1-01      tacaagc--------aacgcccgacgaatctcgcagtgaccgcatcgaat
A0A3B3WI27_BCL2L1-      tccgatccaacacatattgcccaatgagcc---cccggacagcaccgct-
A0A3B3XN57_BCL2L1-      ttcaagctctctgctgaggtccgaggccga---cggggccaggaccaatt
                            * *           *      *           *       *    

A0A3B3YT99_BCL2L10      ggg-----------------ctgtggaaagagaccgtggctgttgcagag
A0A3B3YCD0_MCL1-01      ggatatgttgcaaaaagcctcca-gaagagcagcgacgacagcgacgaag
A0A3B3WI27_BCL2L1-      --g-----------------ctg-gggacgcggccggggacgcggggatg
A0A3B3XN57_BCL2L1-      ggg-----------------acg-ggga--cagccggggccctagcaatg
                                                *        *   *           *

A0A3B3YT99_BCL2L10      gattacatccacctg-------------cgctgctcaagcc---------
A0A3B3YCD0_MCL1-01      gctctctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtct
A0A3B3WI27_BCL2L1-      gacgacgagc------------------agacgttggagac---------
A0A3B3XN57_BCL2L1-      gcccgctggt------------------caacagctgggcc---------
                        *    *                                  *         

A0A3B3YT99_BCL2L10      --------------------------------------------------
A0A3B3YCD0_MCL1-01      gctgtacgtgcgagcaaccaagtgctggataacgacacaatggagctcat
A0A3B3WI27_BCL2L1-      -----------------------------------------gcacgctaa
A0A3B3XN57_BCL2L1-      -----------------------------------------ggctcccca

A0A3B3YT99_BCL2L10      -----------------cacacccagcccctccacctcccagcgagccgg
A0A3B3YCD0_MCL1-01      tagcagttttctaagacattttacaggactttcaaagtg----tcggtgg
A0A3B3WI27_BCL2L1-      tgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcgg
A0A3B3XN57_BCL2L1-      gggaagt--------------cccaggaccctc----------ccaccgg
                                               ***      *               **

A0A3B3YT99_BCL2L10      ccgcc------------------------gccatgaggcgcctggcccag
A0A3B3YCD0_MCL1-01      -agtc-------aaaataaagctctatctacgatgaaaagggtggtggag
A0A3B3WI27_BCL2L1-      -cgtcggcggcaacgatggac--------gcggtgaaagtgaccctgcga
A0A3B3XN57_BCL2L1-      -cgtc-------------gag--------gttgtcaaatcggttctgaag
                          * *                            * *              

A0A3B3YT99_BCL2L10      gacgt-----ggaggcccagcaccaggctcgctttcactccctggccca-
A0A3B3YCD0_MCL1-01      gacgttttgtcgaagcacagatatgcatacaatggtatgctc--------
A0A3B3WI27_BCL2L1-      gacac--------ggcccgtgagttcgagctgcgctactccc-gcgcctt
A0A3B3XN57_BCL2L1-      gacgc--------ggcagaggagtttgaacgcctctacacccaaagcttt
                        ***           **             *      *  * *        

A0A3B3YT99_BCL2L10      ----gggcttcctgaagcactgcgggacagacct--------ctgctcca
A0A3B3YCD0_MCL1-01      -aacaggcttgct------ctggataaccagccggaca----atatgggg
A0A3B3WI27_BCL2L1-      caacgaccttcacagcacgctgcacatcacaccggccaccgcgtaccaga
A0A3B3XN57_BCL2L1-      aaacacctttccttgca-gctggacatcacccccgacacggcctaccaga
                                **         ***     *   **          *      

A0A3B3YT99_BCL2L10      acc-tcagaaaggtgatggatgagatggtgggagatggacattttaactg
A0A3B3YCD0_MCL1-01      tttgttacggaagtagcagagaatctcttttcagacgggaccaccaactg
A0A3B3WI27_BCL2L1-      gct-tcgagaacgtgatggacgaggtgttccgggacgg---cgtcaactg
A0A3B3XN57_BCL2L1-      gct-tcaagactgtgctggatgagttattcaagggtga---ggtcaactg
                            *       **    **  *  *  *    *  *        *****

A0A3B3YT99_BCL2L10      ggggagggtggtgtccctcttcgccttcgctggcgtgctggccagacagc
A0A3B3YCD0_MCL1-01      gggtcggatcgtcagcctggtggcgttcggggctgcagtgt---gtcagc
A0A3B3WI27_BCL2L1-      gggccgaatcgtggggctcttcgcgtttggtggcgcgctct---gcgtgg
A0A3B3XN57_BCL2L1-      gggtcgggtggtggccatgtttacctttgggggaattctgt---gtgtgg
                        ***  *  * **     *  *  * ** *  *      *     *   * 

A0A3B3YT99_BCL2L10      tgcgggaacagacgggcaagaacccggggccggactccgggaagcagcag
A0A3B3YCD0_MCL1-01      acctgaaggagaggggcagagagc--------------------------
A0A3B3WI27_BCL2L1-      agtgtgtggagaaggagatgagcc--------------------------
A0A3B3XN57_BCL2L1-      attgcgttcagaagaatatgagtg--------------------------
                                 *** *   *                                

A0A3B3YT99_BCL2L10      gaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgc
A0A3B3YCD0_MCL1-01      -------------attgcgtg---gagctggtgagcaaggaaatatccac
A0A3B3WI27_BCL2L1-      -------------acctggta---gccaggattgtagagtggatgaccgt
A0A3B3XN57_BCL2L1-      -------------agctggtc---tcccgcattgccgaatggatgaccac
                                     *    **                      *       

A0A3B3YT99_BCL2L10      tgattacctggagaagcacaaaaaagactggctgcaggaaaataatggat
A0A3B3YCD0_MCL1-01      gtatctcctggaaaaccagcggga---ctggctagcaaaaaacaactcat
A0A3B3WI27_BCL2L1-      cta---cttggatgagcggattgaaccttgggtggagagccaaggaggat
A0A3B3XN57_BCL2L1-      tta---cctggacgagcagctcaatccctggatccagagccagggaggat
                          *   * ****  * *      *    *** *        *      **

A0A3B3YT99_BCL2L10      gggacgggttt---------tgtagctacgcccacaacgccagagaagta
A0A3B3YCD0_MCL1-01      gggagggctttgtggagttctttagagtatcagatcctgagtctacagtg
A0A3B3WI27_BCL2L1-      gggaccgtttcgctgagatcttcgg------gggcaacgcggcggcagag
A0A3B3XN57_BCL2L1-      gggaccgcttcgctaacctgtacgg------ccaggacgccgctgcagag
                        ****  * **          *   *             *       **  

A0A3B3YT99_BCL2L10      ag---------tcaggactcctccatgaagacggcgctggttgctg----
A0A3B3YCD0_MCL1-01      ag--gaacacgctgatggcgtttgttggggtcgctggtattgggg-----
A0A3B3WI27_BCL2L1-      agcagaagatctcaggagagcttcaaaaactggctgctgctggggatgag
A0A3B3XN57_BCL2L1-      ggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggc
                         *                   *          *  * *  * *       

A0A3B3YT99_BCL2L10      -----tcgccggagtcggcatcgcagggctcaccttccttctggtgcgct
A0A3B3YCD0_MCL1-01      -----caacattagcctttctcatcaggt---------------------
A0A3B3WI27_BCL2L1-      tgtggtgac---ggccttcatagccgggtccatcttcgcccagaagcgcc
A0A3B3XN57_BCL2L1-      tctgctgaccggagctctgctcgtcatgt---ttgtcgctaagaaacg--
                                *    *      *      *                      

A0A3B3YT99_BCL2L10      ag---
A0A3B3YCD0_MCL1-01      ---ga
A0A3B3WI27_BCL2L1-      tgtga
A0A3B3XN57_BCL2L1-      -atga

© 1998-2022Legal notice