Dataset for CDS BAK1 of Organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W3JVN7_BAK1-01      atg----------------------gcctcaggcgga-------------
A0A4W3K9I8_BAK1-01      atg-------------------gcaactt--ggagca-------------
A0A4W3K9I8_BAK1-02      atg-------------------gcaactt--ggagca-------------
A0A4W3K9I8_BAK1-03      atgtctccagaatcatcttccctcaccttcaggagcacaaaaaaaacatt
                        ***                       * *  ** * *             

A0A4W3JVN7_BAK1-01      ------gatggagatcccttcagatc------------------------
A0A4W3K9I8_BAK1-01      -------gttgtgacccgtgcaggtca-----------------------
A0A4W3K9I8_BAK1-02      -------gttgtgacccgtgcaggtca-----------------------
A0A4W3K9I8_BAK1-03      gccgagtgttgtgctagttgcacaacagtataatataattaaggtacaat
                                * * *     * **   *                        

A0A4W3JVN7_BAK1-01      ----caatc------------tacccaggaaccgaaagaaccttcacagg
A0A4W3K9I8_BAK1-01      ----tgttc---------------------accacatgaagag-----aa
A0A4W3K9I8_BAK1-02      ----tgttc---------------------accacatgaagag-----aa
A0A4W3K9I8_BAK1-03      ctgttgttcgtggcaaggcgccatcaagtaactgcgtgagaaatagtcag
                               **                     **     **           

A0A4W3JVN7_BAK1-01      cgtccttcaag---------------------------------------
A0A4W3K9I8_BAK1-01      gagcagcgaag---------------------------------------
A0A4W3K9I8_BAK1-02      gagcagcgaag---------------------------------------
A0A4W3K9I8_BAK1-03      ggcccactaaatgactttgcctttatttgtttactgttcttatctgaatt
                           *    **                                        

A0A4W3JVN7_BAK1-01      ------------------------gcctgtcacagaggaaggcgttgtac
A0A4W3K9I8_BAK1-01      --------------------------cagacgcagagcagaacatggtaa
A0A4W3K9I8_BAK1-02      --------------------------cagacgcagagcagaacatggtaa
A0A4W3K9I8_BAK1-03      gatgactctccagtcggtttactttccacccacagagcagaacatggtaa
                                                  *   * ***** *   * * *** 

A0A4W3JVN7_BAK1-01      aagagactgaagaggttttcagaagctatgtctttttccggtaccagacc
A0A4W3K9I8_BAK1-01      aagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaact
A0A4W3K9I8_BAK1-02      aagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaact
A0A4W3K9I8_BAK1-03      aagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaact
                        ****  * ** ** ** **  * *  *******     ** ***** ** 

A0A4W3JVN7_BAK1-01      gagagggaagaaggag---ggaatg---------tcccagaggatccaga
A0A4W3K9I8_BAK1-01      gaggtagaagagagagtacaggatggatttgtaacaccggccatgcaaga
A0A4W3K9I8_BAK1-02      gaggtagaagagagagtacaggatggatttgtaacaccggccatgcaaga
A0A4W3K9I8_BAK1-03      gaggtagaagagagagtacaggatggatttgtaacaccggccatgcaaga
                        ***   *****  ***    * ***           ** *     * ***

A0A4W3JVN7_BAK1-01      aatagcagagatgcatcaatcacctgaa---agcaccacagctcttgttg
A0A4W3K9I8_BAK1-01      aatgacag---tccaacaacagtctgggctcagttccacaatgcagatag
A0A4W3K9I8_BAK1-02      aatgacag---tccaacaacagtctgggctcagttccacaatgcagatag
A0A4W3K9I8_BAK1-03      aatgacag---tccaacaacagtctgggctcagttccacaatgcagatag
                        ***  ***   * ** ***    ***     **  *****   *   * *

A0A4W3JVN7_BAK1-01      gacggcagcttgctgtcattggagatgacatcaaccgcagatacgattta
A0A4W3K9I8_BAK1-01      ggcgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgg
A0A4W3K9I8_BAK1-02      ggcgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgg
A0A4W3K9I8_BAK1-03      ggcgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgg
                        * ** ***** ***** *********** ***** *   ***** * *  

A0A4W3JVN7_BAK1-01      gagttccacaatctgctgtcaaccttgccactcaacgccgagaatgcgta
A0A4W3K9I8_BAK1-01      gagtttcggagtgtgctggcatggaacgcactcacacttgagaatatctt
A0A4W3K9I8_BAK1-02      gagtttcggagtgtgctggcatggaacgcactcacacttgagaatatctt
A0A4W3K9I8_BAK1-03      gagtttcggagtgtgctggcatggaacgcactcacacttgagaatatctt
                        ***** *  * * ***** **       ******     ******   * 

A0A4W3JVN7_BAK1-01      tgactacttccgcaaaatagctctcgggctttttgaaagtggtattaact
A0A4W3K9I8_BAK1-01      cgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaact
A0A4W3K9I8_BAK1-02      cgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaact
A0A4W3K9I8_BAK1-03      cgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaact
                         ** * **** ***   * ***    **** *****   *** ** ****

A0A4W3JVN7_BAK1-01      ggggccgtgtgatagctctcctgggctttggttatcgaatggctctttac
A0A4W3K9I8_BAK1-01      ggggccaaatcattgctctgctgagttttggctacaggatgtcaatttac
A0A4W3K9I8_BAK1-02      ggggccaaatcattgctctgctgagttttggctacaggatgtcaatttac
A0A4W3K9I8_BAK1-03      ggggccaaatcattgctctgctgagttttggctacaggatgtcaatttac
                        ******   * ** ***** *** * ***** **  * *** *  *****

A0A4W3JVN7_BAK1-01      gtcttccagaggggtataaagggattcatcagtcaaattgcaaagttcgt
A0A4W3K9I8_BAK1-01      atccatcagagaggaatcttgggattttttggcagaattgcaaagtatgt
A0A4W3K9I8_BAK1-02      atccatcagagaggaatcttgggattttttggcagaattgcaaagtatgt
A0A4W3K9I8_BAK1-03      atccatcagagaggaatcttgggattttttggcagaattgcaaagtatgt
                         **   ***** ** **   ******  *  *   ***********  **

A0A4W3JVN7_BAK1-01      tgccgaatttgttttgagaaatcgaattgcacggtggattgcagctcagg
A0A4W3K9I8_BAK1-01      cgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagg
A0A4W3K9I8_BAK1-02      cgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagg
A0A4W3K9I8_BAK1-03      cgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagg
                         **  * *** *** **  ** * *** ****  *****    ** ****

A0A4W3JVN7_BAK1-01      gcggctgggttgcagctctggatttagacaatgtttatatg-----aagt
A0A4W3K9I8_BAK1-01      gaggctggaccgctgccttttccgtggagaatgccagcctg-----aagt
A0A4W3K9I8_BAK1-02      gaggctggg----tgagtatgcagtgcagtgtggctgcatattattatac
A0A4W3K9I8_BAK1-03      gaggctggg----tgagtatgcagtgcagtgtggctgcatattattatac
                        * ******      *         *  *   **      *      *   

A0A4W3JVN7_BAK1-01      ggatggctggaattctggctgtagttctaatgggag---tatttgtgatc
A0A4W3K9I8_BAK1-01      atctgtgcggcatcgtggctgtggtagtgctgggcg---tggccattgcc
A0A4W3K9I8_BAK1-02      aattatgca----cattattatacaattacataacaaactcttcatagca
A0A4W3K9I8_BAK1-03      aattatgca----cattattatacaattacataacaaactcttcatagca
                           *           *   * *     *           *     *    

A0A4W3JVN7_BAK1-01      cacaagtttta----caggccttaa-----------------
A0A4W3K9I8_BAK1-01      cacggggttta----caag---taa-----------------
A0A4W3K9I8_BAK1-02      tatttgataaatgatcaaa---taaaaatggatcctgtatag
A0A4W3K9I8_BAK1-03      tatttgataaatgatcaaa---taaaaatggatcctgtatag
                         *   * *  *    **     ***                 

© 1998-2023Legal notice