Dataset for CDS BAK1 of Organism Callorhinchus milii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|V9L3D5_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=648 residues).
atggcaacttggagcagttgtgacccgtgcaggtcatgttcaccacatgaagagaagagcagcgaagcagacgcagagca
gaacatggtaaaagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagagagtac
aggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgggctcagttccacaatgcagataggg
cgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgggagtttcggagtgtgctggcatggaacgcact
cacacttgagaatatcttcgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaactggggccaaatca
ttgctctgctgagttttggctacaggatgtcaatttacatccatcagagaggaatcttgggattttttggcagaattgca
aagtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctggaccgctgccttttc
cgtggagaatgccagcctgaagtatctgtgcggcatcgtggctgtggtagtgctgggcgtggccattgcccacggggttt
acaagtaa
© 1998-2020Legal notice