Dataset for CDS BAK1 of Organism Callorhinchus milii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A4W3JVN7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=654 residues).
atggcctcaggcggagatggagatcccttcagatccaatctacccaggaaccgaaagaaccttcacaggcgtccttcaag
gcctgtcacagaggaaggcgttgtacaagagactgaagaggttttcagaagctatgtctttttccggtaccagaccgaga
gggaagaaggagggaatgtcccagaggatccagaaatagcagagatgcatcaatcacctgaaagcaccacagctcttgtt
ggacggcagcttgctgtcattggagatgacatcaaccgcagatacgatttagagttccacaatctgctgtcaaccttgcc
actcaacgccgagaatgcgtatgactacttccgcaaaatagctctcgggctttttgaaagtggtattaactggggccgtg
tgatagctctcctgggctttggttatcgaatggctctttacgtcttccagaggggtataaagggattcatcagtcaaatt
gcaaagttcgttgccgaatttgttttgagaaatcgaattgcacggtggattgcagctcagggcggctgggttgcagctct
ggatttagacaatgtttatatgaagtggatggctggaattctggctgtagttctaatgggagtatttgtgatccacaagt
tttacaggccttaa
>gnl|bcl2dbcds|A0A4W3KJU8_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=828 residues).
atgtctccagaatcatcttccctcaccttcaggagcacaaaaaaaacattgccgagtgttgtgctagttgcacaacagta
taatataattaaggtacaatctgttgttcgtggcaaggcgccatcaagtaactgcgtgagaaatagtcagggcccactaa
atgactttgcctttatttgtttactgttcttatctgaattgatgactctccagtcggtttactttccacccacagagcag
aacatggtaaaagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagagagtaca
ggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgggctcagttccacaatgcagatagggc
gtcagctggctgtgattggagatgagatcaatcagcgatacaagtgggagtttcggagtgtgctggcatggaacgcactc
acacttgagaatatcttcgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaactggggccaaatcat
tgctctgctgagttttggctacaggatgtcaatttacatccatcagagaggaatcttgggattttttggcagaattgcaa
agtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctgggtgagtatgcagtgc
agtgtggctgcatattattatacaattatgcacattattatacaattacataacaaactcttcatagcatatttgataaa
tgatcaaataaaaatggatcctgtatag
>gnl|bcl2dbcds|A0A4W3KJU8_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Callorhinchus milii GN=BAK1 (length=648 residues).
atggcaacttggagcagttgtgacccgtgcaggtcatgttcaccacatgaagagaagagcagcgaagcagacgcagagca
gaacatggtaaaagaagcagaggatgtctttcggaattatgtctaccagcgttaccaaactgaggtagaagagagagtac
aggatggatttgtaacaccggccatgcaagaaatgacagtccaacaacagtctgggctcagttccacaatgcagataggg
cgtcagctggctgtgattggagatgagatcaatcagcgatacaagtgggagtttcggagtgtgctggcatggaacgcact
cacacttgagaatatcttcgagtccttctgcagtgttgctgaaaggctgtttgatgctgggatcaactggggccaaatca
ttgctctgctgagttttggctacaggatgtcaatttacatccatcagagaggaatcttgggattttttggcagaattgca
aagtatgtcgcaaagtttatttggaagaaccaaatagcacaatggatcatggcgcagggaggctggaccgctgccttttc
cgtggagaatgccagcctgaagtatctgtgcggcatcgtggctgtggtagtgctgggcgtggccattgcccacggggttt
acaagtaa
© 1998-2020Legal notice