Dataset for CDS BCL-2-like of organism Nothobranchius furzeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1A8A7I9_MCL1-01      atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctca
A0A1A8A7I9_MCL1-03      atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctca
A0A1A8A7I9_MCL1-02      atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctca
A0A1A8VCB0_BCL2L10      ---------------------------atgggcggagggctaaatgcgca
A0A1A8VCB0_BCL2L10      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      atgtctcaa---aacca----------agaactagttcttttctatatta
A0A1A8A2S0_BCL2L1-      atgccacacagtaacag----------agagctggtggagtactacatca
                                                                          

A0A1A8A7I9_MCL1-01      aaatggagtcgtggatggaccattacactacggaccgggagattcccctc
A0A1A8A7I9_MCL1-03      aaatggagtcgtggatggaccattacactacggaccgggagattcccctc
A0A1A8A7I9_MCL1-02      aaatggagtcgtggatggaccattacactacggaccgggagattcccctc
A0A1A8VCB0_BCL2L10      gaagggaagcggtgattgcccc----------------gaggttctcctt
A0A1A8VCB0_BCL2L10      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      gatataaactgt----------------------cacagaggaactatcc
A0A1A8A2S0_BCL2L1-      gctacaagttgt----------------------cccaaaggaactgtcc
                                                                          

A0A1A8A7I9_MCL1-01      ctc--------acatcgcaactggcgccacgttagactctgctaatggga
A0A1A8A7I9_MCL1-03      ctc--------acatcgcaactggcgccacgttagactctgctaatggga
A0A1A8A7I9_MCL1-02      ctc--------acatcgcaactggcgccacgttagactctgctaatggga
A0A1A8VCB0_BCL2L10      ccgccgtctggatgtggcgagagctgtcac--------ctaccgctggga
A0A1A8VCB0_BCL2L10      -----------atgtggcgagagctgtcac--------ctaccgctggga
A0A1A7ZDF6_BCL2L1-      cctcaaccacatagtcctcaatgaccccctaaacaggactggtgcggggg
A0A1A8A2S0_BCL2L1-      c-------------------atgtctc---------------tgctgggg
                                              *                       *** 

A0A1A8A7I9_MCL1-01      -----acgtagagtccggtgacggccccaaacgcccgagcaacctggaag
A0A1A8A7I9_MCL1-03      -----acgtagagtccggtgacggccccaaacgcccgagcaacctggaag
A0A1A8A7I9_MCL1-02      -----acgtagagtccggtgacggccccaaacgcccgagcaacctggaag
A0A1A8VCB0_BCL2L10      ggagaacatgggaccagtgatcgggccagcatgtctacgt--ccggacca
A0A1A8VCB0_BCL2L10      gg------------------------------------------------
A0A1A7ZDF6_BCL2L1-      atgcggtggtggggggtgaggag----gagaggacagagacacacgccaa
A0A1A8A2S0_BCL2L1-      c--cagaggatgggggtaagaagactcgggaggactggga-------caa
                                                                          

A0A1A8A7I9_MCL1-01      tgtctccgc--acaatggatttgctgctaaacgcttcagccacgaggagg
A0A1A8A7I9_MCL1-03      tgtctccgc--acaatggatttgctgctaaacgcttcagccacgaggagg
A0A1A8A7I9_MCL1-02      tgtctccgc--acaatggatttgctgctaaacgcttcagccacgaggagg
A0A1A8VCB0_BCL2L10      tgggtccct--accaggggcgtg--gctagcctctcttacagcaaaatg-
A0A1A8VCB0_BCL2L10      -------------------------------------------aaaatg-
A0A1A7ZDF6_BCL2L1-      tgggacctttaaca--ggacgagtcccgggac-----cccagcggcgt--
A0A1A8A2S0_BCL2L1-      ttcagctgctagcaatggccgg----ctggtc-----agcagcaggga--
                                                                          

A0A1A8A7I9_MCL1-01      aggacggctctctgccgtgcaccccggagtttcacgcaggcagcgagacc
A0A1A8A7I9_MCL1-03      aggacggctctctgccgtgcaccccggagtttcacgcaggcagcgagacc
A0A1A8A7I9_MCL1-02      aggacggctctctgccgtgcaccccggagtttcacgcaggcagcgagacc
A0A1A8VCB0_BCL2L10      ------------tcctgtgggctgtggaatgatactctggc--tgtggcc
A0A1A8VCB0_BCL2L10      ------------tcctgtgggctgtggaatgatactctggc--tgtggcc
A0A1A7ZDF6_BCL2L1-      --------------c--cccgctacggcagcagccgccggc---------
A0A1A8A2S0_BCL2L1-      --------------cagcccaccagggaag-----acttgt---------
                                      *      *   **         *  *          

A0A1A8A7I9_MCL1-01      gag--------gtcccc-a-gcggtcatgccggagatgaggcgctggcga
A0A1A8A7I9_MCL1-03      gag--------gtcccc-a-gcggtcatgccggagatgaggcgctggcga
A0A1A8A7I9_MCL1-02      gag--------gtcccc-a-gcggtcatgccggagatgaggcgctggcga
A0A1A8VCB0_BCL2L10      gaggattacctgtccac-gtgctgctgcggcccaaatccagccc------
A0A1A8VCB0_BCL2L10      gaggattacctgtccac-gtgctgctgcggcccaaatccagccc------
A0A1A7ZDF6_BCL2L1-      -----------gtccacgacg--gacatggaccgggtgaaa---------
A0A1A8A2S0_BCL2L1-      -----------gccccccgtggtggcatggaggcagtgaaa---------
                                   * ** *   *  *    *       *             

A0A1A8A7I9_MCL1-01      acgacaccagacaactaatcaaccgcttttttatggagttta---ctgga
A0A1A8A7I9_MCL1-03      acgacaccagacaactaatcaaccgcttttttatggagttta---ctgga
A0A1A8A7I9_MCL1-02      acgacaccagacaactaatcaaccgcttttttatggagttta---ctgga
A0A1A8VCB0_BCL2L10      -ctccacctcccagcgagacagccgctgccatgaggcgtctggcccagga
A0A1A8VCB0_BCL2L10      -ctccacctcccagcgagacagccgctgccatgaggcgtctggcccagga
A0A1A7ZDF6_BCL2L1-      ---gaggccctccgagacacggccaac--------gagttcgagctgcga
A0A1A8A2S0_BCL2L1-      ---tcagctctaaaggactcagcagat--------gagtttgaactttta
                               *        *  *  *            * **          *

A0A1A8A7I9_MCL1-01      cagttaaagcctcagtggcgcgatagcagagagctatcgacaatgaaaag
A0A1A8A7I9_MCL1-03      cagttaaagcctcagtggcgcgatagcagagagctatcgacaatgaaaag
A0A1A8A7I9_MCL1-02      cagttaaagcctcagtggcgcgatagcagagagctatcgacaatgaaaag
A0A1A8VCB0_BCL2L10      ta--tggagacccagcacc----------agacccgtttcc---------
A0A1A8VCB0_BCL2L10      ta--tggagacccagcacc----------agacccgtttcc---------
A0A1A7ZDF6_BCL2L1-      ta----------------------cgcccgcgccttcaacg---------
A0A1A8A2S0_BCL2L1-      ta----------------------cgcacagagttttagtc---------
                         *                                                

A0A1A8A7I9_MCL1-01      agtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatgg
A0A1A8A7I9_MCL1-03      agtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatgg
A0A1A8A7I9_MCL1-02      agtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatgg
A0A1A8VCB0_BCL2L10      -----------actctctgg-----ctcaga---acttcctgaagc---g
A0A1A8VCB0_BCL2L10      -----------actctctgg-----ctcaga---acttcctgaagc---g
A0A1A7ZDF6_BCL2L1-      ----------------------------------acctgcacagcca--g
A0A1A8A2S0_BCL2L1-      ----------------------------------acctttccctgca--g
                                                           * *           *

A0A1A8A7I9_MCL1-01      ctgcgaaatgcacttccgatgacctgacg-ttcatcagcaaagtggcaga
A0A1A8A7I9_MCL1-03      ctgcgaaatgcacttccgatgacctgacg-ttcatcagcaaagtggcaga
A0A1A8A7I9_MCL1-02      ctgcgaaatgcacttccgatgacctgacg-ttcatcagcaaagtggcaga
A0A1A8VCB0_BCL2L10      ctgcgggccagacatctgct-------ct-agcctcaggaaggtgatgga
A0A1A8VCB0_BCL2L10      ctgcgggccagacatctgct-------ct-agcctcaggaaggtgatgga
A0A1A7ZDF6_BCL2L1-      ctgcacatcacgcccgccacggcctaccaaagcttcgagaacgtgatgga
A0A1A8A2S0_BCL2L1-      ctcgatatcacgccagacacggcctaccacagcttcaagagcgtgctgga
                        **          *              *    * **   *  ***   **

A0A1A8A7I9_MCL1-01      aaacatgttttcagacgggatcaccaactggggtcggatcgtgagcctgc
A0A1A8A7I9_MCL1-03      aaacatgttttcagacgggatcaccaactggggtcggatcgtgagcctgc
A0A1A8A7I9_MCL1-02      aaacatgttttcagacgggatcaccaactggggtcggatcgtgagcctgc
A0A1A8VCB0_BCL2L10      cgagatggctggagacggacactttaactgggggcgggttgtgtccctct
A0A1A8VCB0_BCL2L10      cgagatggctggagacggacactttaactgggggcgggttgtgtccctct
A0A1A7ZDF6_BCL2L1-      cgaggtgttccgggacgg---cgtcaactgggggcgcatcgtgggactct
A0A1A8A2S0_BCL2L1-      cgagctgttcagagatgg---ggtaaactggggacgggtggtgggcctct
                          *  **      ** **       ******** **  * ***   **  

A0A1A8A7I9_MCL1-01      tggccttcggggcggtggtggcc---------cagtaccagaaggac---
A0A1A8A7I9_MCL1-03      tggccttcggggcggtggtggcc---------cagtaccagaaggac---
A0A1A8A7I9_MCL1-02      tggccttcggggcggtggtggcc---------cagtaccagaaggac---
A0A1A8VCB0_BCL2L10      ttgcttttactggggtgctgatcagacagctgcaggagcagaggacctcc
A0A1A8VCB0_BCL2L10      ttgcttttactggggtgctgatcagacagctgcaggagcagaggacctcc
A0A1A7ZDF6_BCL2L1-      tcgcgttcggcggcgcgctgtgtgtagagtgcgtggagaaggag------
A0A1A8A2S0_BCL2L1-      ttgtctttggggggttgctgtgtgtgcagtgtaaggagaggaat------
                        * *  **    *    * **              * *   *         

A0A1A8A7I9_MCL1-01      --aacggg----------aggcaaaa----caacgtagagctagtcagcc
A0A1A8A7I9_MCL1-03      --aacggg----------aggcaaaa----caacgtagagctagtcagcc
A0A1A8A7I9_MCL1-02      --aacggg----------aggcaaaa----caacgtagagctagtcagcc
A0A1A8VCB0_BCL2L10      agaccggggctggaccctgggcaagagctggaac-cgaagctcatcagct
A0A1A8VCB0_BCL2L10      agaccggggctggaccctgggcaagagctggaac-cgaagctcatcagct
A0A1A7ZDF6_BCL2L1-      -----------------------------------atgagtcccctggtg
A0A1A8A2S0_BCL2L1-      -----------------------------------ttaagcgagctggtt
                                                              **       *  

A0A1A8A7I9_MCL1-01      at------------gaggtttcaac---ctacctgttgtctcaacagaga
A0A1A8A7I9_MCL1-03      at------------gaggtttcaac---ctacctgttgtctcaacagaga
A0A1A8A7I9_MCL1-02      at------------gaggtttcaac---ctacctgttgtctcaacagaga
A0A1A8VCB0_BCL2L10      gtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaa
A0A1A8VCB0_BCL2L10      gtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaa
A0A1A7ZDF6_BCL2L1-      gtcag--gatcgtggagtggatgaccgtctacctggacaaccacattcag
A0A1A8A2S0_BCL2L1-      ccccg--cattgcagactggatgaccacctacctggatgatcagatcggg
                                      **        *    ******      **       

A0A1A8A7I9_MCL1-01      gactttctgctcagaaacaactcatggcaaggctttgtggagttcttt--
A0A1A8A7I9_MCL1-03      gactttctgctcagaaacaactcatggcaaggctttgtggagttcttt--
A0A1A8A7I9_MCL1-02      gactttctgctcagaaacaactcatggcaaggctttgtggagttcttt--
A0A1A8VCB0_BCL2L10      ggctggctgttggagaatgaaggatgggaaggcttcagccagtactcc--
A0A1A8VCB0_BCL2L10      ggctggctgttggagaatgaaggatgggaaggcttcagccagtactcc--
A0A1A7ZDF6_BCL2L1-      ccctggatccagagtcagggaggatgggagcgcttcgccgacatctttgg
A0A1A8A2S0_BCL2L1-      ctgtggatcagcagccaaggaggatgggactgttttgcagagatttatgg
                           *   *        *      **** *  * **     *    *    

A0A1A8A7I9_MCL1-01      ------cgt-gtaacagac--------ccagagtcaacag-------tca
A0A1A8A7I9_MCL1-03      ------cgt-gtaacagac--------ccagagtcaacag-------tca
A0A1A8A7I9_MCL1-02      ------cgt-gtaacagac--------ccagagtcaacag-------tca
A0A1A8VCB0_BCL2L10      ------cacaacaccagaccagtaagtctggactcctcca-------tga
A0A1A8VCB0_BCL2L10      ------cacaacaccagaccagtaagtctggactcctcca-------tga
A0A1A7ZDF6_BCL2L1-      gcacgacgcggcggctga------aagcaggaggttccaggagagcttta
A0A1A8A2S0_BCL2L1-      gcgaggagctgcggcaga------ggcaaggaggttccaggagaccctga
                                      * **            **     *         * *

A0A1A8A7I9_MCL1-01      ggaacacactgatggc--------catagctggggtagcaggcatgg--g
A0A1A8A7I9_MCL1-03      ggaacacactgatggc--------catagctggggtagcaggcatgg--g
A0A1A8A7I9_MCL1-02      ggaacacactgatggc--------catagctggggtagcaggcatgg--g
A0A1A8VCB0_BCL2L10      agacagcgctggttgc--------tgttgctgg---agttggcctggctg
A0A1A8VCB0_BCL2L10      agacagcgctggttgc--------tgttgctgg---agttggcctggctg
A0A1A7ZDF6_BCL2L1-      ggatgtggctgctggtgggaatgaccgtgctca--cggcggtcgtggcag
A0A1A8A2S0_BCL2L1-      agaagtggctgttagcaggagtgctgctgctgt--caggggtgctgctcg
                         **     *** * *             ***      *  *   **   *

A0A1A8A7I9_MCL1-01      ggcgactctagccctgctgatcag--------------------------
A0A1A8A7I9_MCL1-03      ggcgactctagccctgctgatcag--------------------------
A0A1A8A7I9_MCL1-02      ggcgactctagccctgctgatcagttgttgcaggcatgacaccagttttc
A0A1A8VCB0_BCL2L10      ggctaacct--ttctcctggtgcg--------------------------
A0A1A8VCB0_BCL2L10      ggctaacct--ttctcctggtgcg--------------------------
A0A1A7ZDF6_BCL2L1-      gctcgctgt--tcgcgcagaaacgcct-----------------------
A0A1A8A2S0_BCL2L1-      gtgtgctca--ttgcaaagaaacg--------------------------
                        *                 *    *                          

A0A1A8A7I9_MCL1-01      -------------------------gtga
A0A1A8A7I9_MCL1-03      -------------------------gtga
A0A1A8A7I9_MCL1-02      agacagttccctcaataccttcatattga
A0A1A8VCB0_BCL2L10      -------------------------ctag
A0A1A8VCB0_BCL2L10      -------------------------ctag
A0A1A7ZDF6_BCL2L1-      -------------------------gtga
A0A1A8A2S0_BCL2L1-      -------------------------gtga
                                                  *  

© 1998-2021Legal notice