Dataset for CDS BCL2A1 of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6QF32_BCL2A1-      atgactgactgtgaattcacatctgtctactctttggctgaggactatct
A0A8C6R201_BCL2A1-      ---------------------------tactctttggctgaggactatct
                                                   ***********************

A0A8C6QF32_BCL2A1-      tcagtatgtcctacaagttcccttgtttgaatcggctccaagcaaaacgt
A0A8C6R201_BCL2A1-      tcagtatgtcctacaagttccctcgtttgaatcggctccaa---------
                        *********************** *****************         

A0A8C6QF32_BCL2A1-      ccagagtgctacaaaaagttgctttctcagtccaaaaagaagttgaaaag
A0A8C6R201_BCL2A1-      ------------------ttgttttctcagtccaaaaagaagttgaacag
                                          *** ************************* **

A0A8C6QF32_BCL2A1-      aatctgaaaccatacttggacaattttgatgtggtatccatagatacagc
A0A8C6R201_BCL2A1-      aatctgaaactatacttggacaattttgatgttgtacccacagatacagc
                        ********** ********************* *** *** *********

A0A8C6QF32_BCL2A1-      tagaacaatattcaatcaagtgatggaaaaagaatttgaagatggtatta
A0A8C6R201_BCL2A1-      tagtacaatattcaatcaagtgatggaaaaagaatttgaagatggtatca
                        *** ******************************************** *

A0A8C6QF32_BCL2A1-      ttaactgggggaggattgtgaccatatttgcttttgggggtgttctcctc
A0A8C6R201_BCL2A1-      ttaactgggggaggattgtgaccatatttgcttttgggggtgttttcctc
                        ******************************************** *****

A0A8C6QF32_BCL2A1-      aagaaacttccacaagagcagatggacttggatgtggatacttacaagca
A0A8C6R201_BCL2A1-      aaggaacttccacaagagcagatggacttggatgtggatacctacaagca
                        *** ************************************* ********

A0A8C6QF32_BCL2A1-      agtttcttattttgtggctgaattcataatgaataacacaggagaatgga
A0A8C6R201_BCL2A1-      agtttcttgttttgtggctgaattcataaagaataacacaggagaatgga
                        ******** ******************** ********************

A0A8C6QF32_BCL2A1-      tacgtcaaaatggaggttgggaagatggcttcataaggaaatttgaacct
A0A8C6R201_BCL2A1-      tacgtcaaaatggaggttgggtatatggcttcataaggaagtttgaacct
                        ********************* * **************** *********

A0A8C6QF32_BCL2A1-      aagtctggctggctgacttttctggaagtcatgggacagatctgggaact
A0A8C6R201_BCL2A1-      aagtctggctggctgacttttctggaagtcatgggacagatctgggaatt
                        ************************************************ *

A0A8C6QF32_BCL2A1-      gatctttctcctgaagcaccatcattga
A0A8C6R201_BCL2A1-      gatctttctcctgaag------------
                        ****************            

© 1998-2022Legal notice