Dataset for CDS Unclassified of organism Callorhinchus milii

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A4W3H280_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callorhinchus milii (length=366 residues).
ggaatcgtgaaccgcttgaacatctccgacaggggtgacctgaatgccatcgagaaggttggcactgaaatgttcagcga
tggtgagatgaattggggcagggtagtgagcttcatcgccttcggagcagtcatgggagaacgccttgccgacatgcaga
tgcaagacttaattgacttggtggctgaggagataacacaatacctgacgcaacagaagagagagtggcttcagaaacac
aacggctgggatggtttcacggagtttttcgaggagaatgatctggaagactccacaaaaaaggtactgatggtggtcgc
aagtgttggcttggccggggcaggcatcctgcactggttaagatga
>gnl|bcl2dbcds|A0A4W3H3E3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callorhinchus milii (length=402 residues).
atgaggactgtttctgttgtggttgcaggagtaggcattagcaataccagccacagtaagaaacaaaattatttgttggt
cacaatgtccattttctcaataggaatagtgaatcacttaaacatctcaggcaagagagatctaaatgccatcaagaagg
ttggtactgaaatgttcagtgatggtgaaatgaattggggcagggtggtcagcttcatcgcctttggagcagtcatggga
gagcacctggcaaaacttcagctggatgacttaatcgatttgatggctgaagaaatcacacagtacttgactcaacagaa
aagagagtggcttcagaaacacaacggttgggtaaggaggtcttttggaaaaccctttgatcaagaaaatcagtgcactt
ag
>gnl|bcl2dbcds|A0A4W3HHG3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Callorhinchus milii (length=690 residues).
atgtacaccgagaccatgtcctacgagagccgtgagctggtgtttcactacctgtattaccgtgtgtcccggcacggcta
tgtgtgggaggaggctctgggcagcgctgccgactccccgcacaccagcacccccccggccccggccccggcccccgccc
ccgcctcggccgccctggagaagctgcaccgtgtcctgcgggaggtgggcgacagcttcgagcggcagtaccagcaggag
ttcgccgacatcgcgctgcagatgcgctttgagccggacggcgcccgcagccgcttcgacgctgtggccgaggagctgtt
ccgagatgggatcaactggggccgcatcgtggctttcttcgtcttcggcggcaccttgtgcgtggagagctgcaagagga
gggacatggccccgctggtggacagcatcgccgcctggatgaccgcctacctggacagcagcctggccaactggatcagc
gccaatggagactgggtatgtgcagggcacccactgcccgagtgtgtgcagggcacccactgcccgagtgtgtgcagggc
acccactgcccgagtgtgtgggtgtagggtacccattgccctatgtgtgtgtgtagggtacccattgccctgtgtgtgtg
tgtgtatgtatagggtacccattgccctatgtgtgtgtgtgtgtgtatag
>gnl|bcl2dbcds|A0A4W3JU32_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Callorhinchus milii (length=594 residues).
atggcgctgagcagccgggctctggtggaggatttcctgggctataagctccggcagcgggggcactgttggccgccgag
cgaggcccaggcccaggccgcggggccgggtagcgcggggccggaggaggaggaggaggcggagcgggtccgggtggcgc
tgcgggaggcggccgaggagttcgagctgaggtaccgcagggctttccgcggcctcgcggcccaactccatgtcaccccc
gacaccgcgtaccagcgctttgagcaggtggtcggagagctgttccgcgatggcgtcaactggggccgcatcgtcgcctt
tttctgcttcggcggcgctctgagcgccgagagtctggacaaggagatggcgccgctcgtcccgcgcatcgcgtcctgga
tgatcatctacatggagagcaatctgcagccctggatcctgcagcacggcggctgggaggcttttgtggccctgtacggc
aataatgcagctgcccggagccgccacatacaggagaccgtgacctggctgatgactctggtggctgtgggcgccggtct
ggctatcgccgtgttcctggcccggagaagataa
>gnl|bcl2dbcds|A0A4W3JUE6_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Callorhinchus milii (length=666 residues).
atgcggcagtgcgtgagagaggaagcgcggcagctggccggcgactacctggaccactgcctgtacccgggccgccaggc
caggcctcccagccgtacggccgagaccctccgcaaagtcaccgaccagatggtggagcagcaccaggccgccttcagca
gcatgaagagccgcttcgacaacggcttgcgcttcagctccaagccggcggcatcggaggcggcggcggcggctgctccc
gctgctcccgctgctgcgaccgtggttgcgggagaggccgccgcggaggcgacgagggcggctgtggcggccggggactt
cctgcgccgggtggtggaggaaatgtcggccgacgagaagatgaactggggccgggtggtgagcgtgttcgcgttcgccg
gcgtcttgagccggcacctgagggactcgggcatcgttatgtgcccggcgaccggccccagccccctggactcgctggcg
gacagtgtggccaactacctgggcaaggagaagagggagtggattgagcagaacggaggctgggagggatttctcagatt
ctttggcagcaatgaccattggcaagaatcaacagtacgcaatatgctgataacagttgctgggtttggtatagcaggga
tagcttgtcttcttgcagttcgatag
© 1998-2020Legal notice