Dataset for CDS BCL-2-like of organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8P0F1_BCL2L1-      atgtctcaaaacagagaacttgtgcttttctacataaggtataa------
A0A3P8NP63_MCL1-02      atggccaac---------------------tatatgatgttgaaaaggaa
A0A3P8NP63_MCL1-01      atggccaac---------------------tatatgatgttgaaaaggaa
A0A3P8NP63_MCL1-03      atggccaac---------------------tatatgatgttgaaaaggaa
A0A3P8PVZ8_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3P8QVM8_BCL2-01      atggagaacgagt---------------------------------ataa
                        ***    *                                          

A0A3P8P0F1_BCL2L1-      -----------------actctcccagagaaactatcctctcaa------
A0A3P8NP63_MCL1-02      ccagt------------gcaccttaatgga--atatcttattcc-----t
A0A3P8NP63_MCL1-01      ccagt------------gcaccttaatgga--atatcttattcc-----t
A0A3P8NP63_MCL1-03      ccagt------------gcaccttaatgga--atatcttattcc-----t
A0A3P8PVZ8_BCL2L10      ccacacttccgctggttattccgtggcggtg-gtgtcttctttccacagt
A0A3P8QVM8_BCL2-01      tcgca------------atattgtggaaaagtatatctgccataaactct
                                                         * **             

A0A3P8P0F1_BCL2L1-      ccacatagtactcaacgagccttcgaacaggactgatgggggg-------
A0A3P8NP63_MCL1-02      caaaatgg--------ag---------------tcttggaggg------a
A0A3P8NP63_MCL1-01      caaaatgg--------ag---------------tcttggaggg------a
A0A3P8NP63_MCL1-03      caaaatgg--------ag---------------tcttggaggg------a
A0A3P8PVZ8_BCL2L10      ccacacga--------cgttcccagcacaaaaatcatgtcgagaggcgga
A0A3P8QVM8_BCL2-01      ccaagcgg--------gggt-------------tcgtgtgggg-------
                        * *                              *  **  * *       

A0A3P8P0F1_BCL2L1-      -----gca----gcggggttggatgaggaacagcgaatagacacaca-cg
A0A3P8NP63_MCL1-02      ccaatgcactacggatc--------gggaaattcctct--ccgcagaacg
A0A3P8NP63_MCL1-01      ccaatgcactacggatc--------gggaaattcctct--ccgcagaacg
A0A3P8NP63_MCL1-03      ccaatgcactacggatc--------gggaaattcctct--ccgcagaacg
A0A3P8PVZ8_BCL2L10      gtcacgcattctgcatcagctgaagggaagactcaact------gtaccg
A0A3P8QVM8_BCL2-01      -------atttcgcgttgtccaagaagaagatgctgctaataacggatcg
                               *    *             * *    *   *        * **

A0A3P8P0F1_BCL2L1-      ccaatgggacttttaatggcacga-------------gtc---------c
A0A3P8NP63_MCL1-02      ccacaggctcctctaaagactctagcaatgggattgtgtccaatggtacc
A0A3P8NP63_MCL1-01      ccacaggctcctctaaagactctagcaatgggattgtgtccaatggtacc
A0A3P8NP63_MCL1-03      ccacaggctcctctaaagactctagcaatgggattgtgtccaatggtacc
A0A3P8PVZ8_BCL2L10      ac-gctctccttccgccgtctgta--------------------tgtg-c
A0A3P8QVM8_BCL2-01      ataactgaccctccaccgactttg-------------gtccaccggtg-c
                                 * *     * *                             *

A0A3P8P0F1_BCL2L1-      cgggaccccaccggcatccccg----------------------------
A0A3P8NP63_MCL1-02      cccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaac
A0A3P8NP63_MCL1-01      cccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaac
A0A3P8NP63_MCL1-03      cccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaac
A0A3P8PVZ8_BCL2L10      agagagcagtctgatatcgctg-----------------ggaggaaaatg
A0A3P8QVM8_BCL2-01      cgagaa------gccagcaccg-----------------gg---------
                            *       *  * *   *                            

A0A3P8P0F1_BCL2L1-      ------cagcggc----ggcagcagcagccgccatcaacgacggacct--
A0A3P8NP63_MCL1-02      aaaagctatccgggaccgggaggaagacggttcgttgccgagcaccccgg
A0A3P8NP63_MCL1-01      aaaagctatccgggaccgggaggaagacggttcgttgccgagcaccccgg
A0A3P8NP63_MCL1-03      aaaagctatccgggaccgggaggaagacggttcgttgccgagcaccccgg
A0A3P8PVZ8_BCL2L10      aaattctgtgggctgtggaaagagaccctggttttggccgaggactacct
A0A3P8QVM8_BCL2-01      ----cctgacggc----gagagcaacacccacctctgcagacggctccc-
                                   *     *  **                 **         

A0A3P8P0F1_BCL2L1-      ----------------cgacgcagtgaaggaggcgctccgggacacggcc
A0A3P8NP63_MCL1-02      agtttcattcggacagtgaatccga---cgagcagctggagagagaaacg
A0A3P8NP63_MCL1-01      agtttcattcggacagtgaatccga---cgagcagctggagagagaaacg
A0A3P8NP63_MCL1-03      agtttcattcggacagtgaatccga---cgagcagctggagagagaaacg
A0A3P8PVZ8_BCL2L10      gtccttttgctgca--cgagtccacat-caagcccctccacctcccagcg
A0A3P8QVM8_BCL2-01      --------acagtc--cga-cccacacgcaggcatccacagagtcctgcg
                                         **  *         *   *            * 

A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P8NP63_MCL1-02      aaactccttattcacagttttttgggtgactttattggactttctcagcc
A0A3P8NP63_MCL1-01      aaactccttattcacagttttttgggtgactttattggactttctcagcc
A0A3P8NP63_MCL1-03      aaactccttattcacagttttttgggtgactttattggactttctcagcc
A0A3P8PVZ8_BCL2L10      aatcagccgctgc------catgaggcgtctaggctgg------------
A0A3P8QVM8_BCL2-01      -----------------------------cgaggctgga-----------

A0A3P8P0F1_BCL2L1-      --aatgagttcgagctgcgatacgctcgtgccttcagcgaccttcacagc
A0A3P8NP63_MCL1-02      tcaacgaaaagaaaccaaagcactaaagacgatgaaaagagttgttgcgg
A0A3P8NP63_MCL1-01      tcaacgaaaagaaaccaaagcactaaagacgatgaaaagagttgttgcgg
A0A3P8NP63_MCL1-03      tcaacgaaaagaaaccaaagcactaaagacgatgaaaagagttgttgcgg
A0A3P8PVZ8_BCL2L10      -----gacatcgaaagacagcaccaagctcgctt-------------cga
A0A3P8QVM8_BCL2-01      --gatgaacttgaaagactgtaccagccggacttcacggagatgtcgcgg
                             **     *        **         *               * 

A0A3P8P0F1_BCL2L1-      ----------------cagctgcacatcacgcc----------------g
A0A3P8NP63_MCL1-02      acgtattagaaaagcacagatacg-cttacaacggaatgattaataaatt
A0A3P8NP63_MCL1-01      acgtattagaaaagcacagatacg-cttacaacggaatgattaataaatt
A0A3P8NP63_MCL1-03      acgtattagaaaagcacagatacg-cttacaacggaatgattaataaatt
A0A3P8PVZ8_BCL2L10      ----------------caacctcg-ctcagacc----------------t
A0A3P8QVM8_BCL2-01      ----------------cagctgcatctcacctc----------------c
                                        **    *   * *   *                 

A0A3P8P0F1_BCL2L1-      gccacggcctaccaa------------------agcttcgagaacgtgat
A0A3P8NP63_MCL1-02      gtcattggatgaaagagacgaggatatgtcatttg--tcggtgctgtagc
A0A3P8NP63_MCL1-01      gtcattggatgaaagagacgaggatatgtcatttg--tcggtgctgtagc
A0A3P8NP63_MCL1-03      gtcattggatgaaagagacgaggatatgtcatttg--tcggtgctgtagc
A0A3P8PVZ8_BCL2L10      tcc-tggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgat
A0A3P8QVM8_BCL2-01      tccacggcgcagagg------------------aggttcgccgaggtgat
                          *   *                           *  **      **   

A0A3P8P0F1_BCL2L1-      ggacgaggtgttccgggacggc---gttaactggggccgcatcgtagggc
A0A3P8NP63_MCL1-02      gaagagcctctttggagaccacacgaccaactggggtcgtattgtcagct
A0A3P8NP63_MCL1-01      gaagagcctctttggagaccacacgaccaactggggtcgtattgtcagct
A0A3P8NP63_MCL1-03      gaagagcctctttggagaccacacgaccaactggggtcgtattgtcagct
A0A3P8PVZ8_BCL2L10      gaaggagctggttggagatggacacttgaactgggggagggttgtttctc
A0A3P8QVM8_BCL2-01      agacgaactgttccgggacggg---gtgaactggggccggattattgctt
                          *     *  *  * **          ********  *  *  *     

A0A3P8P0F1_BCL2L1-      ttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggag---
A0A3P8NP63_MCL1-02      ttatggccttc---ggggcagtggtctctcagcacctgaaggaaaag---
A0A3P8NP63_MCL1-01      ttatggccttc---ggggcagtggtctctcagcacctgaaggaaaag---
A0A3P8NP63_MCL1-03      ttatggccttc---ggggcagtggtctctcagcacctgaaggaaaag---
A0A3P8PVZ8_BCL2L10      ttttcgcctttactggagtgctggccagaaagatcctggagcagaagccg
A0A3P8QVM8_BCL2-01      tcttcgagtttg--ggggcactgt-------gtgcgtggagtg-------
                        *  * *  **    ** *   **        *  * *  **         

A0A3P8P0F1_BCL2L1-      --------------------------------atgagccccttggtgggc
A0A3P8NP63_MCL1-02      -------------------ggcagggacaactacgtggcgcta-gtgagc
A0A3P8NP63_MCL1-01      -------------------ggcagggacaactacgtggcgcta-gtgagc
A0A3P8NP63_MCL1-03      -------------------ggcagggacaactacgtggcgcta-gtgagc
A0A3P8PVZ8_BCL2L10      gggctggaccctcgtcaacagcaggaactgggacaggagccca--tgagc
A0A3P8QVM8_BCL2-01      ------------cgcttccaacgag----gggatgtcatcccaggtggac
                                                        *       *    **  *

A0A3P8P0F1_BCL2L1-      aggatcgtagagtgg--------atgacggtctacctagacaaccacatt
A0A3P8NP63_MCL1-02      ca----agag-------------atttctgcatacctgctgtctgaacag
A0A3P8NP63_MCL1-01      ca----agag-------------atttctgcatacctgctgtctgaacag
A0A3P8NP63_MCL1-03      ca----agag-------------atttctgcatacctgctgtctgaacag
A0A3P8PVZ8_BCL2L10      tgca--gaaggctggcagagaccatagctgattacctgggagaagagaag
A0A3P8QVM8_BCL2-01      aacatcgcagactgg--------atgacggagtatttaaatggacctctt
                                **             **  * *  **  *             

A0A3P8P0F1_BCL2L1-      cagccctggatccagagccaaggaggatgggagcgcttcgctgaaatctt
A0A3P8NP63_MCL1-02      cgagactggattgtaaaaaacaatgcatgggatggctttgtggagttctt
A0A3P8NP63_MCL1-01      cgagactggattgtaaaaaacaatgcatgggatggctttgtggagttctt
A0A3P8NP63_MCL1-03      cgagactggattgtaaaaaacaatgcatgggatggctttgtggagttctt
A0A3P8PVZ8_BCL2L10      aaagactggctgttggataatgatggatgggaaggcttctgtaagttctc
A0A3P8QVM8_BCL2-01      aacagctggatacaagataacgggggatgggatgcatttgtggagctgta
                             **** *        *    * ******    **     *  * * 

A0A3P8P0F1_BCL2L1-      cgg-------gcaggatgcggcggctgaaagccggaggtc-----tcagg
A0A3P8NP63_MCL1-02      tcg-agtagcagaccctgagtcgatagtcaggc---acacactcat---g
A0A3P8NP63_MCL1-01      tcg-agtagcagaccctgagtcgatagtcaggc---acacactcat---g
A0A3P8NP63_MCL1-03      tcg-agtagcagaccctgagtcgatagtcaggc---acacactcat---g
A0A3P8PVZ8_BCL2L10      ccgcagtgccagaga----------agtgagccaggactcatccatgaag
A0A3P8QVM8_BCL2-01      cgacagacagagggactccgtcttcagttgctcctggccc-tccatcaag
                                                  *     *      *     *   *

A0A3P8P0F1_BCL2L1-      agagtttcaagaagtggctgctggtggggat--gacggtggtgacaggcg
A0A3P8NP63_MCL1-02      gcctttgc-tggatttgctggtattggggcaacactggccctgttgatca
A0A3P8NP63_MCL1-01      gcctttgc-tggatttgctggtattggggcaacactggccctgttgatca
A0A3P8NP63_MCL1-03      gcctttgc-tggatttgctggtattggggcaacactggccctgttgatca
A0A3P8PVZ8_BCL2L10      aaagcgct----gtttgctgccgccgg---t--gtcggccttgct-----
A0A3P8QVM8_BCL2-01      acagtttt-cggcttggctgcgctcggagcg--gccagcctcacc-atcg
                                      * ****     **          *            

A0A3P8P0F1_BCL2L1-      ttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga-----
A0A3P8NP63_MCL1-02      -----------gatctt---ctac----aatcttttga-----
A0A3P8NP63_MCL1-01      -----------gttgctgggatgc----attattgtga-----
A0A3P8NP63_MCL1-03      -----------gtggt----------------ttgtaa-----
A0A3P8PVZ8_BCL2L10      -----------gggcttaccttcc----tc-ttggtgcgctag
A0A3P8QVM8_BCL2-01      -----------gagcataccttac----acaaaagtga-----
                                   *                       *       

© 1998-2022Legal notice