Dataset for CDS BCL2L1 of organism Salvator merianae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8D0E1K1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salvator merianae GN=BCL2L1 (length=675 residues).
atgtcgagcgggaaccgcgcgctcgtcatagactttatctcctacaagctctcccagaggggccacaactggagcgacct
ggaggggaacggcgaggacaggactgagctggccgaggggatgagcggcgtccccaacgggagcccctcgtgggcctccg
gcagcagcccggtgacgaacggggcgaccgggcacccgagcatccttgaagacaacgccaggtgggacgtgaggcagacg
ctcagggaggcgggcgatgagtttgaactgaggtaccggcgggctttcagcgacctgacgtcccagctgcacatcacccc
cggcaccgcttaccagagctttgagcaggtggtgaacgaactctttcgggacggggtgaactgggggcggattgtggcgt
ttttctccttcggaggagccctgtgcgtggagagcgtcgacaaggagatgcacgtgctggtgagtcggatcgccgtctgg
atgaccacttacctgactgaccatctggagccgtggatccaagataatgggggctgggaccggtttgtggatctctatgg
gaatgacgccgctgccaagagccggaagggccaagaacgcttcaacaagtggctgttgacgggggccaccgtggccgggg
tcctgctcctcggctccctgctgagccgcaaatag
© 1998-2023Legal notice