Dataset for CDS Unclassified of organism Sarcophilus harrisii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7N4P7A1_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii (length=1254 residues).
atggagcctccgcagattcccaggaggcgcctggactttgggagcagctctgactcggggagcagctctgactcggggag
cagctctgactcggggagcagccgggactcggggagcagctctgactcggggagcagctctgactcgggaagcagccggg
actcggggagcagctctgactcggggagcagctctgactcggggagcagctctgactcggggagcagccgggactcgggg
agcagctctgactcggggaccagctctgactcggggagcagctctgactcggggaccagctctcttaggcggacacccct
tctcccagtcccactcctctcccctctcctcttccctctcctttcccctctcctctcccctcccaatccttccagccgcc
tccctgaccgcaactgcagcaacgcggcttcaggggaatcggggcgttcccccctcgaggccgggccgagtggcagcagc
gagccctggaccctctgctccccggagaacgagcttgaggccctcgggggctctcggagcgcccctccttcgacgtggca
ggcccggccagagccggccgccgaatcgctccagtgcatttccagactggtgatcgggaattacctcctgggccgggcct
accgcttcacccacggcaggggccacagctgtcccggctcctgggggcccagccccaacggccgcgcgggaagcggccga
ggccccgagggcagctcggggggcccccgtggccgccgccgccccgacctagagcccgccccccgcggcggccccggctc
ccgccctcgcctcccttctaacgcctcctcacgttgtcgactcccggccttgtgcatcaacacccttaaggccgtcgggg
gggacctgcagctgcggcacaaaggcgtcttcgaggacctgatgcggcgactggcccagcagcgccgagtctggcctcgg
accttggtccggatcacgagagacgcgttcagcggcggccccaccaactggggccgggtggcggccgtgctggccttcgt
ccgcttcgtgctgaggggagtggggctgctggagggcgcgagcctgctctcggaccgcatctcggacaccctggtgcggg
cgcaggaggcctggctgcggcagcagaggggctggcgggggctggtccgcttcttttacggggaagacctcgaagggttc
ctggggaacgcttcggggaactggggcttcgtctgtcccctagcttatgtgtag
© 1998-2021Legal notice