Dataset for CDS MCL-1 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1L3L7_MCL1-01      atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccggg
G1L3L7_MCL1-02      atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccggg
                    ************************************************************

G1L3L7_MCL1-01      ttgggggccggcagcggcggcgccgcctcatcgggagggcggcttttggcttcggggaag
G1L3L7_MCL1-02      ttgggggccggcagcggcggcgccgcctcatcgggagggcggctttt-------------
                    ***********************************************             

G1L3L7_MCL1-01      gaggccacggcccggagggagatagggggaggggaagccggtgcggtgattggcggaagc
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      gccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgag
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      cccacccgccgcgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatg
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggaacctttggggaagcggccggctgtc
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      ctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggag
G1L3L7_MCL1-02      ------------------------------------------------------------
                                                                                

G1L3L7_MCL1-01      attatctctcggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggc
G1L3L7_MCL1-02      --------------------------ggcaacaggcgccaaggacgcgaaaccgctgggc
                                              **********************************

G1L3L7_MCL1-01      gggtctggggcggccagccggaaggcgttagagaccctccgacgggtcggggacggggta
G1L3L7_MCL1-02      gggtctggggcggccagccggaaggcgttagagaccctccgacgggtcggggacggggta
                    ************************************************************

G1L3L7_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
G1L3L7_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
                    ************************************************************

G1L3L7_MCL1-01      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaac
G1L3L7_MCL1-02      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaac
                    ************************************************************

G1L3L7_MCL1-01      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagt
G1L3L7_MCL1-02      tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagt
                    ************************************************************

G1L3L7_MCL1-01      ataaaccaagaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
G1L3L7_MCL1-02      ataaaccaagaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaagg
                    ************************************************************

G1L3L7_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
G1L3L7_MCL1-02      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
                    ************************************************************

G1L3L7_MCL1-01      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
G1L3L7_MCL1-02      gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgga
                    ************************************************************

G1L3L7_MCL1-01      gtaggagctggtttggcatatctaataagatag
G1L3L7_MCL1-02      gtaggagctggtttggcatatctaataagatag
                    *********************************

© 1998-2022Legal notice