Dataset for CDS BAX-like of Organism Haplochromis burtoni

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A3Q2UWG8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Haplochromis burtoni GN=BOK (length=642 residues).
atggaggtcctgcgcaggtcttcagtgtttgctgcagaggtcctggatgtgtttgaccgatcactgaccgagaaggagct
ggtgacccagtctaaggcgctgtgcagagactacatcttgtcgaggctcaaccaaaacgggttgggatggtctaaaactg
aactccatttttctccctcaaacgcagcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctggagtgt
atacagcccagtttgtacaggaacgtggcacggcagctcaacatttctgttgccatggagaacatggtttcggatgcctt
catcggtgtagcaacagagattttctcagcaggcataacatggggtaaggtggtgtccatgtttgcggtagctggagccc
tggcagtggactgtgtcagacaaggccatccggctacagtgcacatcttagtggacagtctgggacagtttgtccgcaaa
ttcctggttccctggctgaagcgacggggaggatgggtaagtttctgcctcagcaaaattttgggcaaacatgaaatgca
taaaaagttgacatttgagatacaacagcgatttgcatttgctagttttgtgtgtgtgtgcaggggtggggtggggattt
ga
>gnl|bcl2dbcds|A0A3Q2V329_BAX-01 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=615 residues).
atggcatcacacccgggaggaggcgatcaaggtagtggcagctatcgtcaacaaataaaatacatatatttcgactctga
cagtatggcttactgttgtgtatttgtgctgtatagtttcatctatgagcgagttcagaggcaaggagatggcaataatg
cagtgacgagagaacagcttggtggaagccagctgactgacccaaaacataagaagcttgctcagtgcctgcagcagatt
ggagatgagctggatggaaatgtagagctccaaagaatgataaatgactcttcgctttgtcccacaagagaggtttttat
gagagtggcctatgagatcttttcagatggaatatttaactggggcagggaggttgcactgttctactttgcatgccgac
tcgttatcaaagctcttgtaactcagattccggatattatcagaaccattatcagttggaccatagactatctccgggaa
catgtgatcaactggatcagggagcaaggtggctgggagggtattcgctcctactttggcacaccaacatggcagacggt
cggagttttcttggcaggagtccttaccactgttcttgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A3Q2V329_BAX-02 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=573 residues).
atgagtgtctacctttgtctttcagggaattccggagatcagatactggaagtcggaactattttgttacaggatttcat
ctatgagcgagttcagaggcaaggagatggcaataatgcagtgacgagagaacagcttggtggaagccagctgactgacc
caaaacataagaagcttgctcagtgcctgcagcagattggagatgagctggatggaaatgtagagctccaaagaatgata
aatgactcttcgctttgtcccacaagagaggtttttatgagagtggcctatgagatcttttcagatggaatatttaactg
gggcagggaggttgcactgttctactttgcatgccgactcgttatcaaagctcttgtaactcagattccggatattatca
gaaccattatcagttggaccatagactatctccgggaacatgtgatcaactggatcagggagcaaggtggctgggagggt
attcgctcctactttggcacaccaacatggcagacggtcggagttttcttggcaggagtccttaccactgttcttgtcat
tcgcaagatgtga
>gnl|bcl2dbcds|A0A3Q2VJY7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=585 residues).
gcaatatgcaaaacatgcaagaagagaatcacagacagagatggaacaacttccaactttgtccgacagttgaagactgt
ctttatgtatgtgattgcacatataaacacagaggagcccagtcgacacgtgacttctgaggatttgggaggaaggccag
atgaacaacaggatccacaagtcaaagaagtggtagaacagctgcgcaagatagccgacagtttaaaccgcaatgctgag
cttcagagactgataaaccaggttcaggggaactgcgttcaagatgtcttcatggcagttgcaagaaacatctttgctga
tggcatcaactggggtcgagtagtggctctcttccatctggcctgtaaacttatacacaaggctattaccgccaatcact
tagagaacatccaaatgatcatcagctgggtcctccaggtcatcagggagcaggtctacagctggcttgtggcacaaggg
ggctgggagggggtgatccgtggtttctctcgatggaggacagcagccatggtagcatcagtagtattggtggtagcctt
tgtttactaccggaaagtacgataa
>gnl|bcl2dbcds|A0A3Q2VJY7_BAX-02 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=609 residues).
tactcggacttttacaccatgaccgctgctgtgatttggtgttgtttgaagtttactgaggagaatctttgtataataaa
attgtgggtgtttttttttgtctgctacaggtatgtgattgcacatataaacacagaggagcccagtcgacacgtgactt
ctgaggatttgggaggaaggccagatgaacaacaggatccacaagtcaaagaagtggtagaacagctgcgcaagatagcc
gacagtttaaaccgcaatgctgagcttcagagactgataaaccaggttcaggggaactgcgttcaagatgtcttcatggc
agttgcaagaaacatctttgctgatggcatcaactggggtcgagtagtggctctcttccatctggcctgtaaacttatac
acaaggctattaccgccaatcacttagagaacatccaaatgatcatcagctgggtcctccaggtcatcagggagcaggtc
tacagctggcttgtggcacaagggggctgggagggggtgatccgtggtttctctcgatggaggacagcagccatggtagc
atcagtagtattggtggtagcctttgtttactaccggaaagtacgataa
>gnl|bcl2dbcds|A0A3Q2VJY7_BAX-03 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=573 residues).
atgacctgctctacttcctgtgatgcaaatctttgtataataaaattgtgggtgtttttttttgtctgctacaggtatgt
gattgcacatataaacacagaggagcccagtcgacacgtgacttctgaggatttgggaggaaggccagatgaacaacagg
atccacaagtcaaagaagtggtagaacagctgcgcaagatagccgacagtttaaaccgcaatgctgagcttcagagactg
ataaaccaggttcaggggaactgcgttcaagatgtcttcatggcagttgcaagaaacatctttgctgatggcatcaactg
gggtcgagtagtggctctcttccatctggcctgtaaacttatacacaaggctattaccgccaatcacttagagaacatcc
aaatgatcatcagctgggtcctccaggtcatcagggagcaggtctacagctggcttgtggcacaagggggctgggagggg
gtgatccgtggtttctctcgatggaggacagcagccatggtagcatcagtagtattggtggtagcctttgtttactaccg
gaaagtacgataa
>gnl|bcl2dbcds|A0A3Q3C2Q2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=489 residues).
atggcttactgttgtgtatttgtgctgtatagtttcatctatgagcgagttcagaggcaaagagatggcaatagggcagt
gacgagagaacagcttgatggaagccagctgactgacccaaaacataagaagcttgctcagtgcctgcagcatattggag
acgagctggatggaaatgtagagctccaaagaatgataaataactcttcgctttgtcccacaagaaaggtttttatgaga
gtggcctctgagatcttttcagatggaatatttaactggggcagggtggttgcactgttctactttgcatgccgactcgt
tatcaaagtacgtgaaactgctattgccgattcccccgttactaccctgttggtcacttcatgttttgttttcataccag
caataaagctgaggtttttgagtttcacgttagtgtctgagtcctgcgtttggatcctcctctccgcctgcccgcacaca
gagccctga
>gnl|bcl2dbcds|A0A3Q3CU65_BAX-01 BCL2-associated X gene OS=[Eukaryota] Haplochromis burtoni GN=BAX (length=498 residues).
acccccatgtccccctgcatgccacggggtcctggttggcccaacttgccctctttacctggcagtcctcggctgccctc
gggtcctttatttcccgtctctcctgatatgactttaaatggacctgcattaaaagtccatttaatgcaggtccaaagaa
tgataaatgactcttcgctttgtcccacaagagaggtttttatgagagtggcctatgagatcttttcagatggaatattt
aactggggcagggaggttgcactgttctactttgcatgccgactcgttatcaaagctcttgtaactcagattccggatat
tatcagaaccattatcagttggaccatagactatctccgggaacatgtgatcaactggatcagggagcaaggtggctggg
agggtattcgctcctactttggcacaccaacatggcagacggtcgaagttttcttggcaggagtccttaccactgttctt
gtcattcgcaagatgtga
© 1998-2023Legal notice