Dataset for CDS BCL-2-like of organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4RFB4_MCL1-01      atgaatcctgcgcttgcaactatgaaccgcagccccgctaccagcctagt
A0A8C4STP1_BCL2L1-      atg--ccctaca---gcaacaaag------------------agctagtt
A0A8C4XBF6_BCL2L1-      atg--tcttaca---gcaacagag------------------agcttgtt
                        ***   * * *    *****   *                  ***    *

A0A8C4RFB4_MCL1-01      ccagatgttatactgctctggaccgtcgggtttgaatggcgtttttaagc
A0A8C4STP1_BCL2L1-      gaagattttataa-gctataaattatct---cagaaaaatttttcat---
A0A8C4XBF6_BCL2L1-      gaagattttatca-gctacaaattatcg---cagaaaaatgttttga---
                          **** ****   ***    *   **      ***     ***      

A0A8C4RFB4_MCL1-01      acgatgccctgcatcttgcgaagggggctgactttacgggaagcacgcaa
A0A8C4STP1_BCL2L1-      ---gtaaccagtatttcgga---------gacagtaggactgccacacca
A0A8C4XBF6_BCL2L1-      ---atagcc-----------------------------------------
                            *  **                                         

A0A8C4RFB4_MCL1-01      atgatgtcggtgcagctggatgaaggcgagctagacgattgtttggatga
A0A8C4STP1_BCL2L1-      gggacctccactc------ctgagaatgaacaagat--------------
A0A8C4XBF6_BCL2L1-      ----------------------agagtgaactggat--------------
                                              *    ** *  **               

A0A8C4RFB4_MCL1-01      ggtcgattcagtctcgcagcttcacaagtc--ctcgtcgaagaattgctt
A0A8C4STP1_BCL2L1-      ----------gtgctacatgtcaatggctctgtcagtggaacaga-----
A0A8C4XBF6_BCL2L1-      ----------gtattacaggtcaatgggac------tggaataat-----
                                  **    **  *  *     *      * *** *       

A0A8C4RFB4_MCL1-01      aaaaaatctcctgttctcggccgagagctcaaatgcagatggctctcttc
A0A8C4STP1_BCL2L1-      ------------------------------aaatggaggcagctcttc--
A0A8C4XBF6_BCL2L1-      ------------------------------caat------agcttccc--
                                                       ***       ***      

A0A8C4RFB4_MCL1-01      cagcatctccggagacgccttctagcccaatgg----acagcagtcagcc
A0A8C4STP1_BCL2L1-      ------------tgcagaccactcgcctgatggtatcagagcagtaaaag
A0A8C4XBF6_BCL2L1-      ------------agccactccagcatctaatggagttaaagcagtaaaag
                                     *            *  ****    * ****** *   

A0A8C4RFB4_MCL1-01      cggatttacgcctgctgctgacgcccagctggcgcaggaaacagaggagc
A0A8C4STP1_BCL2L1-      aggcactcca-------------------tgactcgggggat----gagt
A0A8C4XBF6_BCL2L1-      aggcacttcg-------------------tggctcaggggac----gagt
                         **   * *                    ** * * **  *     *** 

A0A8C4RFB4_MCL1-01      tt--attgcggcctacttatttcgatcggccggattaccctgctcacgta
A0A8C4STP1_BCL2L1-      ttgagttgaggt------------accgggctgctttcagtgatctctca
A0A8C4XBF6_BCL2L1-      ttgagctgaggt------------accgggctgctttcaatgaccttgct
                        **    ** **             * *** * * ** *  **  *     

A0A8C4RFB4_MCL1-01      tccgtaatggaaacaaatctttcgacacccttgtacgtgttggggattct
A0A8C4STP1_BCL2L1-      tcc----cagctgcacat-------caccccag-----------------
A0A8C4XBF6_BCL2L1-      tcg----cagctacatat-------cacccctg-----------------
                        **       *   ** **       *****  *                 

A0A8C4RFB4_MCL1-01      gtcatcgagaaacataaattcgcgtttaacggaatgctccggaagcttaa
A0A8C4STP1_BCL2L1-      ------------------ttaccgcttaccaaag----------------
A0A8C4XBF6_BCL2L1-      ------------------ttacagcttaccagag----------------
                                          **   * *** *  *                 

A0A8C4RFB4_MCL1-01      tatctcccaggagggagacatgggattcatgacccctgttgctgaaagca
A0A8C4STP1_BCL2L1-      ---ctttgagcaa------------------------gttatcaacgaac
A0A8C4XBF6_BCL2L1-      ---cttcgaggag------------------------gttgttggcgaac
                           **   ** *                         ***          

A0A8C4RFB4_MCL1-01      tcttcagcgatggagtgataaactggggacgtgttgtaagcttggtagcg
A0A8C4STP1_BCL2L1-      tcttccgagatggggtg---aactggggacgtatagtggcactcttcgca
A0A8C4XBF6_BCL2L1-      tcttcagagatggagtg---aactggggacgcatagtggcactcttttca
                        ***** * ***** ***   ***********  * **     *  *  * 

A0A8C4RFB4_MCL1-01      tttggggcagtggta---gccaagcacctaaagcaagtcaacctagaacg
A0A8C4STP1_BCL2L1-      tttggtggtgctctgtgtgtggaatgtgtggagaagg---aaatgggttc
A0A8C4XBF6_BCL2L1-      tttggtggtgcgctctgtgttgaatgtgtggagaagg---aaatggttcc
                        ***** *  *   *    *   *     *  ** * *   *  * *    

A0A8C4RFB4_MCL1-01      ctgcatcaggcctttggcagaccagatttctactttcctgcttacacgcc
A0A8C4STP1_BCL2L1-      tttggtgaaacgcatagctgaatggatgaccacctacttggacaataacc
A0A8C4XBF6_BCL2L1-      tcttgtgagacatatagcagactggatgaccacctacttggataataaca
                             * *  *   * ** **   ***  * ** * * **   *    * 

A0A8C4RFB4_MCL1-01      aaaaggattggattgtgaataacagagcttgggagggctttgtagagttc
A0A8C4STP1_BCL2L1-      tagatccctggatccagagacaaggaggatgggacacgttcgccaaaatc
A0A8C4XBF6_BCL2L1-      ttgatgcctggatcctgagtaatggaggatgggatacctttgtcaggatc
                           *    *****   **   *  ***  *****    ** *      **

A0A8C4RFB4_MCL1-01      tttcgcattgaagatccagaagcag--gaatacgacaggccttgatcacc
A0A8C4STP1_BCL2L1-      t-----acgggagcaac-gcggctgccgagtgccggaggtcccaggaacg
A0A8C4XBF6_BCL2L1-      t-----atggacgacac-gcatcagccgagt------------------a
                        *     *  *  *   * *   * *  ** *                   

A0A8C4RFB4_MCL1-01      ttt----------------gctggaatggc--aggcattggagctggtat
A0A8C4STP1_BCL2L1-      tttcagtaggtggctgttggcaggaatgactctggctactggcctgatgc
A0A8C4XBF6_BCL2L1-      tttcaagaagtggctggtggttggagtgactatgactgctggactggtgt
                        ***                *  *** ** *   * *    *  *** *  

A0A8C4RFB4_MCL1-01      tg----cttatttgatccg---------atga
A0A8C4STP1_BCL2L1-      tgggctcctacttcttccacaaacgcttgtag
A0A8C4XBF6_BCL2L1-      tggcctcctttattgcacacacccatctgtag
                        **    * *   *    *           *  

© 1998-2022Legal notice