Dataset for CDS BAX-like of Organism Buteo japonicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9Z9A2_BOK-01       --------------------------------atggaggtgctacgccgt
A0A8C0AQK9_BAK1-01      cccctgcccggctgcagcctcccgctcgccgtgcaacgggctcgtggctt
A0A8C0HK19_BAX-01       --------------------------------------------------
                                                                          

A0A8B9Z9A2_BOK-01       tcctcagtctttgctgcagaa----------gtgatggagg---------
A0A8C0AQK9_BAK1-01      ccacgggtattttttagcgaagcactaccaggtggtggaggagacggagg
A0A8C0HK19_BAX-01       -------------------------------atgatcgagcaggtgg---
                                                        ** * ***          

A0A8B9Z9A2_BOK-01       -------tttttgacaggtctcccactgac--------------------
A0A8C0AQK9_BAK1-01      aggtgtttcggagctatgccttctaccgctaccaacaggagagagaggag
A0A8C0HK19_BAX-01       ---------ggtgccatgccccc---------------------------
                                    *  * * *  *                           

A0A8B9Z9A2_BOK-01       ---------aaggagcttgtgtcccaagccaaggctctctgcagagacta
A0A8C0AQK9_BAK1-01      agaggggaggaggtgcccatggacc----------------cagagattg
A0A8C0HK19_BAX-01       ---------aaggagctcttcttcc----------------gcgtggctg
                                  *** **   *   **                  * *  * 

A0A8B9Z9A2_BOK-01       cataaat-----tcaaggctaattcgagcgggtgtcagctggagcaaacc
A0A8C0AQK9_BAK1-01      tggagat-----ccagcaggagct-----gggcagcaccgggagccgggt
A0A8C0HK19_BAX-01       cagagatgtttgccgacggcacct----------tcaactggggccgtgt
                           * **      *      *  *           ** * ** **     

A0A8B9Z9A2_BOK-01       tgagtgcaatgcaccagtgcctggtggtaagctggccgaggtgtccgcca
A0A8C0AQK9_BAK1-01      aggaaggcgcctggccatcatcggtgacgacattaataagcggtacgatg
A0A8C0HK19_BAX-01       tg---------ttgccctcttc---------------------tacttcg
                         *            *  *                         * *    

A0A8B9Z9A2_BOK-01       t-----actactgcgactaggggatgagctggaatacattcgcccc----
A0A8C0AQK9_BAK1-01      cggagtttcgctgc-----------atgctgaaatccttgcagcccacca
A0A8C0HK19_BAX-01       c---------ctgc-----------aagctggtg----------------
                                  ****             ****                   

A0A8B9Z9A2_BOK-01       -----aacgtctaccggaatatcgcccgccaattgaacatctcgctgc--
A0A8C0AQK9_BAK1-01      aggagaacgtctacgagcacttcacca-------gaatagcctccagctt
A0A8C0HK19_BAX-01       ----------ctgaaggcactttgcac-------caaggtccctgagctg
                                  **    * *  *  *          **   *     **  

A0A8B9Z9A2_BOK-01       actcggagacggtggtgacggacgcctttctggcagtagc-----tgcgc
A0A8C0AQK9_BAK1-01      gttcgagagcggcattaactggggc----cgggtgattgcgc---tgct-
A0A8C0HK19_BAX-01       gtccgg-------accatcctgggc----tggaccatggagtacatgcg-
                           **             *    **      *    * *      ***  

A0A8B9Z9A2_BOK-01       agattttcact--------gcaggcatc-----------acatggggcaa
A0A8C0AQK9_BAK1-01      gggtttcggctaccgcatggcc---atccacgtctaccagcacggcacaa
A0A8C0HK19_BAX-01       ggatcatgtcc------tggcctggatcca-------------ggcccag
                         * *     *         **    ***               **  ** 

A0A8B9Z9A2_BOK-01       ggttgtgtctctctacgctgtggcagctgggctggcagtggactgtgtgc
A0A8C0AQK9_BAK1-01      gg----ggtttcctctactggatcacccgctacgtctcggagtt-----c
A0A8C0HK19_BAX-01       gg----ag--------gatgggtgagcagggatgggagggagcc-----c
                        **                **    * * *    *     *         *

A0A8B9Z9A2_BOK-01       ggcatgcacagccagccatggttcacaccattgtagattgcctgggagag
A0A8C0AQK9_BAK1-01      atgctccgcaaccg--catcgccc-------agtggatcgcccagcaggg
A0A8C0HK19_BAX-01       ccccccca-aaccg--c--tgctc-------tgc------cccttcagtg
                              *  * **   *   *  *        *       **    ** *

A0A8B9Z9A2_BOK-01       tttgtccgcaagaccttggtgacatggctgaaaaggagaggaggctgggc
A0A8C0AQK9_BAK1-01      ---------------------------------aggatgggtggctgcac
A0A8C0HK19_BAX-01       ---------------------------------ctg------tgctgcac
                                                           *       ****  *

A0A8B9Z9A2_BOK-01       agacatcacaaaatgtgt------ggtgaatactgaccccagccttcgct
A0A8C0AQK9_BAK1-01      tcgagctggacaatgtttacatgaagtacatgctggtggtg---gtggcc
A0A8C0HK19_BAX-01       cgggg---------gctt----------cgtgctggggctgccctttgcc
                                      *  *            * ***          * ** 

A0A8B9Z9A2_BOK-01       ctcactggctcgtggcagctgtttgcagctttggt----cacttcctcaa
A0A8C0AQK9_BAK1-01      ----ctggtcatggtggggcattta-----gtggtacgacgcttcttcag
A0A8C0HK19_BAX-01       ----cagcgctctggcagctacttg-----gtggc------cgccttcga
                            * *      *   *    **       ***       *  * **  

A0A8B9Z9A2_BOK-01       ggctatcttcttcgtcctgctgcccgagagatga
A0A8C0AQK9_BAK1-01      gcc------ctaa---------------------
A0A8C0HK19_BAX-01       tga------ctacg--------------------
                                 **                       

© 1998-2023Legal notice