Dataset for CDS BAX-like of Organism Echeneis naucrates

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A665UQP0_BOK-01      atg---------------------------------------------ga
A0A665V1U7_BOK-01      atg---------------------------------------------ga
A0A665U5E7_BAX-01      atg-----------tccgacag-------ccaaggagaag--agggaaga
A0A665VGJ2_BAX-01      atggcatcatctcacccggcaggaggcgaccaaggaaataccaaagaaca
                       ***                                              *

A0A665UQP0_BOK-01      ggtcctgcggaggt----cctctgtgtttgctgcagaggtcctggacgtg
A0A665V1U7_BOK-01      gatgttgcgccgct----cctctgtgtttgcggctgaa---------gtg
A0A665U5E7_BAX-01      gacggcggcgagctggagcctcaggg--tgccgttgggggaggcgatgtc
A0A665VGJ2_BAX-01      gatactgg-aagtaggtgct-----g--ttctgttgaag-----gatttc
                       *     *    *      *      *  * * *  *            * 

A0A665UQP0_BOK-01      tttgacc-gatcgctgactgagaaggagctggtgtccc---agtcaaagg
A0A665V1U7_BOK-01      tttgacc-gctcgcccaccgacaaggagctggtgtccc---aggccaaag
A0A665U5E7_BAX-01      atagatgatcccattctggagcaaggagcagtggtcctcagagggtatgt
A0A665VGJ2_BAX-01      atctatcagcgggtgcagcaacatggag------------------atgg
                        *  *                 * ****                  *   

A0A665UQP0_BOK-01      ctctgtgcaga-gactacatcctttccagactcaaccagaacgggctggg
A0A665V1U7_BOK-01      cactgtgcagg-gactacattcattccaggctgaaccgtgccggggtagg
A0A665U5E7_BAX-01      gattgaacggataaacacagaggaccctg-ctcgac--acgtcagctcag
A0A665VGJ2_BAX-01      caatgcccaagtgacc----agggcacag-ctgggtggacgagagctc-g
                          **  *     *            * * **            * *  *

A0A665UQP0_BOK-01      atggtccaaggcagaagtgaacctctctccctcgaatgcagcactcgctg
A0A665V1U7_BOK-01      ctggtctaaccctgaacacggactggctgcttcaggtgggacgctgggag
A0A665U5E7_BAX-01      aggatctaggaggcaggccggatgaacaacat--gatccacgagtgaaag
A0A665VGJ2_BAX-01      tggaccca----------------aaccacaa--ga--------------
                         *  * *                  *  *                    

A0A665UQP0_BOK-01      aagtgtctttggttctcctgtgtctcggcgacgagctggaatgtatacag
A0A665V1U7_BOK-01      agatctcgacggttctgctgtggttgggtaacgagctggaatacctacgc
A0A665U5E7_BAX-01      aggtggtagagcagttgctgaagattgcagatgatttgg-----------
A0A665VGJ2_BAX-01      aacttgctgagtgcctgcagaagattggagatgagctgg-----------
                       *  *      *    * * *    * *   * **  ***           

A0A665UQP0_BOK-01      cccagtctgtaccggaacgtggcgcggcagctcaacatctctgttgccat
A0A665V1U7_BOK-01      cccaatgtttaccgtaacgtagcacgacagcttaacatcacagtggcgtc
A0A665U5E7_BAX-01      ----------acagaaatgttgagtttcaacgactgattaaccaggttca
A0A665VGJ2_BAX-01      ----------atggaaatgttgagctccaaaggatgataaacgacccctc
                                 *  * ** ** *     **       **            

A0A665UQP0_BOK-01      ggacaacatggtctcggatgcctttatcggcgtggcaacagaaatcttct
A0A665V1U7_BOK-01      ggagagcgtggtgtctgacgcctttctggctgtggctgcagacattttct
A0A665U5E7_BAX-01      gggaaactgtgctcaggacatcttcatgcaggtggccaggagcatcttca
A0A665VGJ2_BAX-01      agtcaatcccacaaaagacatgttcttgaaggttgccattgagatttttt
                        *  *           **    **  *    ** **       ** **  

A0A665UQP0_BOK-01      caa------------------------caggtataacatggggtaaggtg
A0A665V1U7_BOK-01      ccacagctttttcacttgcgtcattttcaggtgtaacgtggggaaaggtg
A0A665U5E7_BAX-01      cag--------------------atggca---tcaac-tggggtcgagta
A0A665VGJ2_BAX-01      ctg--------------------atggaaaattcaac-tggggcagagtg
                       *                           *     *** *****    ** 

A0A665UQP0_BOK-01      gtatccatgtatgcagtagctggagccctggcagtggactgtgtcagaca
A0A665V1U7_BOK-01      gtgtctctatatgccgtggcaggggccttggcagtggactgcgtacgcca
A0A665U5E7_BAX-01      gtggccctcttc-----------catctggcttacagact-catacacaa
A0A665VGJ2_BAX-01      gttgcgctgttc-----------tactttgcctgtcgact-cgtcatcaa
                       **  *  * *                   *      ****   *     *

A0A665UQP0_BOK-01      aggac------------atccaactaatgtccacatcttagtggacagtc
A0A665V1U7_BOK-01      cggtc------------atccagccatggtccataccattgtcgactgca
A0A665U5E7_BAX-01      ggcactgaccaccaaccatatagagaatatcaggatggtgatcagctggg
A0A665VGJ2_BAX-01      agctcttgtgacccaagttcctgatattatcagaaccatcatcagctgga
                        *  *             *      *   **   *   *  *   * *  

A0A665UQP0_BOK-01      tgggacagtttgtccggaagttcctggttccctggctgaagagacgggga
A0A665V1U7_BOK-01      tgggggaatttgttagtaagagtttgacctcctggttgaaaaaaagaggg
A0A665U5E7_BAX-01      ttctccaggtcatcagagagcagctctactcttggctcatacagcaggga
A0A665VGJ2_BAX-01      ccatggactacctccgggaaaatgtgatcaactggatcagggagcaagga
                             *     *  *  *     *       *** * *        ** 

A0A665UQP0_BOK-01      gggtggatggagattaccaaatgtgtggtgaagagggatctcactcgtga
A0A665V1U7_BOK-01      ggttggatggatgtcacaaaatgtgtggtgaacactgatcccaatttcca
A0A665U5E7_BAX-01      ggctgggagggggtgat------------------tcat---------gg
A0A665VGJ2_BAX-01      ggctgggaggg---cat------------------tcgttcctatttcgg
                       ** ***  **     *                      *           

A0A665UQP0_BOK-01      acactactggctgtcctctgtcatcgagtcactgaagtacttcctcacca
A0A665V1U7_BOK-01      ctctcattggctgatgactgcggtctttgcctttggacactatttgaagg
A0A665U5E7_BAX-01      cttttctcgatggaggacattcactgcagtagcatcagtagtgttggtgg
A0A665VGJ2_BAX-01      cactcccacatggcagacggtaggggttttcttggccggtgtactcacca
                                   *    *                          *     

A0A665UQP0_BOK-01      cgatgtatgtctacatcatgaaggaaccatga
A0A665V1U7_BOK-01      ccatagttttatacctcctcagggagaagtga
A0A665U5E7_BAX-01      cagccattgtttactacagaaagacacgctga
A0A665VGJ2_BAX-01      ctgtcatcgtcattcgcaagatg------tga
                       *        *      *   * *      ***

© 1998-2023Legal notice