Dataset for CDS BCL-2 of organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5MT36_BCL2-03      atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaa
A0A8C5MT36_BCL2-01      atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaa
A0A8C5MT36_BCL2-02      atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaa
A0A8C5MT36_BCL2-04      atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaa
                        **************************************************

A0A8C5MT36_BCL2-03      atatattcattataagctatcacagaggggctatgaatgggaagatggga
A0A8C5MT36_BCL2-01      atatattcattataagctatcacagaggggctatgaatgggaagatggga
A0A8C5MT36_BCL2-02      atatattcattataagctatcacagaggggctatgaatgggaagatggga
A0A8C5MT36_BCL2-04      atatattcattataagctatcacagaggggctatgaatgggaagatggga
                        **************************************************

A0A8C5MT36_BCL2-03      ggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataat
A0A8C5MT36_BCL2-01      ggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataat
A0A8C5MT36_BCL2-02      ggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataat
A0A8C5MT36_BCL2-04      ggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataat
                        **************************************************

A0A8C5MT36_BCL2-03      cattctgatggtgacgaagtgtccgcttcacctggagatccacttggacc
A0A8C5MT36_BCL2-01      cattctgatggtgacgaagtgtccgcttcacctggagatccacttggacc
A0A8C5MT36_BCL2-02      cattctgatggtgacgaagtgtccgcttcacctggagatccacttggacc
A0A8C5MT36_BCL2-04      cattctgatggtgacgaagtgtccgcttcacctggagatccacttggacc
                        **************************************************

A0A8C5MT36_BCL2-03      acgtcacgacacacctctgaatgctgctgcttctacgtcaaataatgcat
A0A8C5MT36_BCL2-01      acgtcacgacacacctctgaatgctgctgcttctacgtcaaataatgcat
A0A8C5MT36_BCL2-02      acgtcacgacacacctctgaatgctgctgcttctacgtcaaataatgcat
A0A8C5MT36_BCL2-04      acgtcacgacacacctctgaatgctgctgcttctacgtcaaataatgcat
                        **************************************************

A0A8C5MT36_BCL2-03      cccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcag
A0A8C5MT36_BCL2-01      cccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcag
A0A8C5MT36_BCL2-02      cccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcag
A0A8C5MT36_BCL2-04      cccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcag
                        **************************************************

A0A8C5MT36_BCL2-03      aggagctctgcttctgctgcttctaccgtcccttcaccacagggtgtgtt
A0A8C5MT36_BCL2-01      aggagctctgcttctgctgcttctaccgtcccttcaccacagggtgtgtt
A0A8C5MT36_BCL2-02      aggagctctgcttctgctgcttctaccgtcccttcaccacagggtgtgtt
A0A8C5MT36_BCL2-04      aggagctctgcttctgctgcttctaccgtcccttcaccacagggtgtgtt
                        **************************************************

A0A8C5MT36_BCL2-03      gaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
A0A8C5MT36_BCL2-01      gaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
A0A8C5MT36_BCL2-02      gaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
A0A8C5MT36_BCL2-04      gaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
                        **************************************************

A0A8C5MT36_BCL2-03      tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggtt
A0A8C5MT36_BCL2-01      tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggtt
A0A8C5MT36_BCL2-02      tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggtt
A0A8C5MT36_BCL2-04      tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggtt
                        **************************************************

A0A8C5MT36_BCL2-03      ctccagactcttagccgagcaggcgatgagttttcccggctgtaccagca
A0A8C5MT36_BCL2-01      ctccagactcttagccgagcaggcgatgagttttcccggctgtaccagca
A0A8C5MT36_BCL2-02      ctccagactcttagccgagcaggcgatgagttttcccggctgtaccagca
A0A8C5MT36_BCL2-04      ctccagactcttagccgagcaggcgatgagttttcccggctgtaccagca
                        **************************************************

A0A8C5MT36_BCL2-03      agactttaggcagatatccgggctcctccacttaaccccatcaacagttc
A0A8C5MT36_BCL2-01      agactttaggcagatatccgggctcctccacttaaccccatcaacagttc
A0A8C5MT36_BCL2-02      agactttaggcagatatccgggctcctccacttaaccccatcaacagttc
A0A8C5MT36_BCL2-04      agactttaggcagatatccgggctcctccacttaaccccatcaacagttc
                        **************************************************

A0A8C5MT36_BCL2-03      gtccacggtttgctgctgtggtggaggaactcttccatgatggggtgaac
A0A8C5MT36_BCL2-01      gtccacggtttgctgctgtggtggaggaactcttccatgatggggtgaac
A0A8C5MT36_BCL2-02      gtccacggtttgctgctgtggtggaggaactcttccatgatggggtgaac
A0A8C5MT36_BCL2-04      gtccacggtttgctgctgtggtggaggaactcttccatgatggggtgaac
                        **************************************************

A0A8C5MT36_BCL2-03      tggggaaggattgtggctttctttgagtttggaggtgtcatgtgcgtgga
A0A8C5MT36_BCL2-01      tggggaaggattgtggctttctttgagtttggaggtgtcatgtgcgtgga
A0A8C5MT36_BCL2-02      tggggaaggattgtggctttctttgagtttggaggtgtcatgtgcgtgga
A0A8C5MT36_BCL2-04      tggggaaggattgtggctttctttgagtttggaggtgtcatgtgcgtgga
                        **************************************************

A0A8C5MT36_BCL2-03      gagtgtgaatcgggagatgtcaccactggtggactccatcgttggttgga
A0A8C5MT36_BCL2-01      gagtgtgaatcgggagatgtcaccactggtggactccatcgttggttgga
A0A8C5MT36_BCL2-02      gagtgtgaatcgggagatgtcaccactggtggactccatcgttggttgga
A0A8C5MT36_BCL2-04      gagtgtgaatcgggagatgtcaccactggtggactccatcgttggttgga
                        **************************************************

A0A8C5MT36_BCL2-03      tgacagagtacctgaataggcatctgcaaaactggatccaggaacaaggc
A0A8C5MT36_BCL2-01      tgacagagtacctgaataggcatctgcaaaactggatccaggaacaaggc
A0A8C5MT36_BCL2-02      tgacagagtacctgaataggcatctgcaaaactggatccaggaacaaggc
A0A8C5MT36_BCL2-04      tgacagagtacctgaataggcatctgcaaaactggatccaggaacaaggc
                        **************************************************

A0A8C5MT36_BCL2-03      ggatgg------ttaaacacattgcctgagattgagacgctgcagagtct
A0A8C5MT36_BCL2-01      ggatgggagtcgtttgtggaattgtatgacagcagcgtcagac---cccc
A0A8C5MT36_BCL2-02      ggatgg-------------------------------------gtgtcat
A0A8C5MT36_BCL2-04      ggatgg--------tgctgggcttccttagagctggttcagacaggacat
                        ******                                            

A0A8C5MT36_BCL2-03      tattcga--------gaaacacagagatcattgcgtcagtcccacagaaa
A0A8C5MT36_BCL2-01      atttgaccccagttggatctccatcaa--gacaatactgagtcttgctgt
A0A8C5MT36_BCL2-02      ttttcaaccttttcta--------cat---acacttcctggtc-------
A0A8C5MT36_BCL2-04      gcttcgactccctgtaagctgcagcatttgacatggccgtggc-------
                          **                                *     *       

A0A8C5MT36_BCL2-03      gaatgaatgcacctggataaagagagcgcagaggattttgacacattctt
A0A8C5MT36_BCL2-01      ggttggagcctgcatcaccataggagcata----ccttggtcaca--agt
A0A8C5MT36_BCL2-02      -----gaggc--ctcatttatagatgctca----a--------------t
A0A8C5MT36_BCL2-04      -----gaggcagccaatcaaattactctca----aggccgaacac--att
                              *  *  *      *      *  *                   *

A0A8C5MT36_BCL2-03      ga
A0A8C5MT36_BCL2-01      ga
A0A8C5MT36_BCL2-02      ga
A0A8C5MT36_BCL2-04      ga
                        **

© 1998-2022Legal notice