Dataset for CDS BCL-2-like of organism Sphaeramia orbicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672Z262_BCL2L1-      atgt----------------------------------------cgcaca
A0A672YCF8_BCL2L10      atg-----------------------------------------------
A0A673A8P7_MCL1-01      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673A8P7_MCL1-02      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673A8P7_MCL1-03      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673A8P7_MCL1-04      atgttaatcgcgagtttaaagttactgattaagatgaatattattccccc
A0A673BZP5_BCL2L1-      atgt-------------------------------------------ctc

A0A672Z262_BCL2L1-      gtaacagggagctg---------------gtggagttcttcatatgctac
A0A672YCF8_BCL2L10      ----aagcga---------------------ggttct-------------
A0A673A8P7_MCL1-01      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673A8P7_MCL1-02      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673A8P7_MCL1-03      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673A8P7_MCL1-04      atcaaagcgtactgcgtttggaatcatgagtgtttctttgcttcatcaaa
A0A673BZP5_BCL2L1-      aaaacagagaactg---------------gtggttttctacataaactat
                             ** *                      *    *             

A0A672Z262_BCL2L1-      a-----------agctgtcg----cagaaaaattaccc------------
A0A672YCF8_BCL2L10      --------------ccttccg-----------------------------
A0A673A8P7_MCL1-01      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673A8P7_MCL1-02      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673A8P7_MCL1-03      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673A8P7_MCL1-04      atggagtcgcggatcctttcggagcagaggactcagcccagtttatccgg
A0A673BZP5_BCL2L1-      a-----------aactctcc----cagagaaactatccca----------
                                      *  *                                

A0A672Z262_BCL2L1-      ---------------------------gtcctctctgctgaggccagatg
A0A672YCF8_BCL2L10      ------------------------ccgtccttatgtgcagagagc-----
A0A673A8P7_MCL1-01      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673A8P7_MCL1-02      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673A8P7_MCL1-03      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673A8P7_MCL1-04      gactcagcccagttcaaccgggcctcggccttggactctcggaacagcaa
A0A673BZP5_BCL2L1-      -------------tcaacc--------acattggactcatagaac-----
                                                       *     *   *  *     

A0A672Z262_BCL2L1-      atgcca-------------------ggactgaaggagacaaggccaacac
A0A672YCF8_BCL2L10      -------------------------agactgatatcgctgggaggaa---
A0A673A8P7_MCL1-01      tccacagcaccgacccaacaatctgggagtgaaagcaaaaaacgagc---
A0A673A8P7_MCL1-02      tccacagcaccgacccaacaatctgggagtgaaagcaaaaaacgagc---
A0A673A8P7_MCL1-03      tccacagcaccgacccaacaatctgggagtgaaagcaaaaaacgagc---
A0A673A8P7_MCL1-04      tccacagcaccgacccaacaatctgggagtgaaagcaaagaacgagc---
A0A673BZP5_BCL2L1-      cccccagca----------------ggactgatggtggagaggcggg---
                                                  ** ***                  

A0A672Z262_BCL2L1-      cactgtctctaatggctt---attggcgaacagtaggaacggaggtggac
A0A672YCF8_BCL2L10      -aatgtcctgtgggctgtggaaagagaccctggctatggcagaggactac
A0A673A8P7_MCL1-01      -acttacccaaaagccttc--aggaggaccgggatgaggcggacgcggac
A0A673A8P7_MCL1-02      -acttacccaaaagccttc--aggaggaccgggatgaggcggacgcggac
A0A673A8P7_MCL1-03      -acttacccaaaagccttc--aggaggaccgggatgaggcggacgcggac
A0A673A8P7_MCL1-04      -acttacccaaaagccttc--aggaggaccgggatgaggcggacgcggac
A0A673BZP5_BCL2L1-      -gttgg----------gtg--aggaacagcgggtaagtacgcatgccaac
                           *             *   *          *      *  * *   **

A0A672Z262_BCL2L1-      aggc------------------------agt-----------ggtgtcgc
A0A672YCF8_BCL2L10      atggccctgtgctgcaca----------ggcccacaggc---ggcccctc
A0A673A8P7_MCL1-01      ggctctctgccctgtacgccggagttccagtccctggagccggacgtgcc
A0A673A8P7_MCL1-02      ggctctctgccctgtacgccggagttccagtccctggagccggacgtgcc
A0A673A8P7_MCL1-03      ggctctctgccctgtacgccggagttccagtccctggagccggacgtgcc
A0A673A8P7_MCL1-04      ggctctctgccctgtacgccggagttccagtccctggagccggacgtgcc
A0A673BZP5_BCL2L1-      gggacttttaatggcaca----------agtcctgggaccc------ctc
                                                     *                   *

A0A672Z262_BCL2L1-      tgccccc------------------------------------cagtgg-
A0A672YCF8_BCL2L10      cacctcc------------------------------------cagcgag
A0A673A8P7_MCL1-01      cagctgcccggcgggacatgaagtcctggaggccgacacaaggcagctta
A0A673A8P7_MCL1-02      cagctgcccggcgggacatgaagtcctggaggccgacacaaggcagctta
A0A673A8P7_MCL1-03      cagctgcccggcgggacatgaagtcctggaggccgacacaaggcagctta
A0A673A8P7_MCL1-04      cagctgcccggcgggacatgaagtcctggaggccgacacaaggcagctta
A0A673BZP5_BCL2L1-      cagcatc----------------tcctg----------tgcggcagcgt-
                           *  *                                    ***    

A0A672Z262_BCL2L1-      -----------------------------------tgacgtagacgcagt
A0A672YCF8_BCL2L10      tcagctgctgccatgaggct------------------cctggcccagga
A0A673A8P7_MCL1-01      ttatcggcttcctcaaagtctttacaggagtttcgaaacctcggtggagt
A0A673A8P7_MCL1-02      ttatcggcttcctcaaagtctttacaggagtttcgaaacctcggtggagt
A0A673A8P7_MCL1-03      ttatcggcttcctcaaagtctttacaggagtttcgaaacctcggtggagt
A0A673A8P7_MCL1-04      ttatcggcttcctcaaagtctttacaggagtttcgaaacctcggtggagt
A0A673BZP5_BCL2L1-      ttaccg------tcaacgac---------------aaacctggactcggt
                                                              * * *     * 

A0A672Z262_BCL2L1-      aaag--gcagcgcttcaggactctgctgatgagtttgagctgctc-----
A0A672YCF8_BCL2L10      cgtggagaggcagcaccaggctcggttc----------------------
A0A673A8P7_MCL1-01      caaaacgaagcactatcaa-------caatgaa-aagagttgtggaggac
A0A673A8P7_MCL1-02      caaaacgaagcactatcaa-------caatgaa-aagagttgtggaggac
A0A673A8P7_MCL1-03      caaaacgaagcactatcaa-------caatgaa-aagagttgtggaggac
A0A673A8P7_MCL1-04      caaaacgaagcactatcaa-------caatgaa-aagagttgtggaggac
A0A673BZP5_BCL2L1-      gaaa--gaggccctccgggactcggccaatgagtttgagctgcgg-----
                              *  **                                       

A0A672Z262_BCL2L1-      ------------tacacgcaggcatttagtgggctgtcctcccagctcga
A0A672YCF8_BCL2L10      ------------ctctccctcgctcagaccttcctga-------------
A0A673A8P7_MCL1-01      cttttggaaaaacacagatacgcatacaatggtatgatcaacaaatt---
A0A673A8P7_MCL1-02      cttttggaaaaacacagatacgcatacaatggtatgatcaacaaatt---
A0A673A8P7_MCL1-03      cttttggaaaaacacagatacgcatacaatggtatgatcaacaaatt---
A0A673A8P7_MCL1-04      cttttggaaaaacacagatacgcatacaatggtatgatcaacaaatt---
A0A673BZP5_BCL2L1-      ------------tacgcccgcgccttcagcgatctgcacaaccagctgca
                                      *      **    *      **              

A0A672Z262_BCL2L1-      catcactcctgacactgcctacca-------------aagctttaaaagt
A0A672YCF8_BCL2L10      ----------ggcagtgtgggccg--gaaccctgttccagcctcaggaag
A0A673A8P7_MCL1-01      ----------gtcattggatgacagaggagatgatatgaggttcgtaagt
A0A673A8P7_MCL1-02      ----------gtcattggatgacagaggagatgatatgaggttcgtaagt
A0A673A8P7_MCL1-03      ----------gtcattggatgacagaggagatgatatgaggttcgtaagt
A0A673A8P7_MCL1-04      ----------gtcattggatgacagaggagatgatatgaggttcgtaagt
A0A673BZP5_BCL2L1-      catcacaccagccactgcatacca-------------aagctttgaaaat
                                  * ** **     *               **  *    *  

A0A672Z262_BCL2L1-      gtcatgg--atgagg-tgttcaaggacggggtc---aactgggggcgtat
A0A672YCF8_BCL2L10      gtgatgg--aggagc-tggtgggcgatggacacttaaactggggaagggt
A0A673A8P7_MCL1-01      gcagtagcaacaagtctctttgaagatgggaccacgaactggggtcgtgt
A0A673A8P7_MCL1-02      gcagtagcaacaagtctctttgaagatgggaccacgaactggggtcgtgt
A0A673A8P7_MCL1-03      gcagtagcaacaagtctctttgaagatgggaccacgaactggggtcgtgt
A0A673A8P7_MCL1-04      gcagtagcaacaagtctctttgaagatgggaccacgaactggggtcgtgt
A0A673BZP5_BCL2L1-      gtgatgg--atgagg-tgtttcgggacggtgtc---aactggggccgcat
                        *   * *  *  **  *  *    ** **   *   ********  *  *

A0A672Z262_BCL2L1-      cgtgggcctgttcgcattcggaggagtcctttgtgtggaatgtgctgaga
A0A672YCF8_BCL2L10      tgtgtcccttttcacctttactggggtgctggccagacagctgatggagc
A0A673A8P7_MCL1-01      tgccagcctggtggccttcggggcagtg--gtgtgtc-agtatcttaaga
A0A673A8P7_MCL1-02      tgccagcctggtggccttcggggcagtg--gtgtgtc-agtatcttaaga
A0A673A8P7_MCL1-03      tgccagcctggtggccttcggggcagtg--gtgtgtc-agtatcttaaga
A0A673A8P7_MCL1-04      tgccagcctggtggccttcggggcagtg--gtgtgtc-agtatcttaaga
A0A673BZP5_BCL2L1-      cgtagggctttttgcattcggcggggcgctctgtgtcgagtgtgtggaga
                         *     **  *  * **    *  *            *        ** 

A0A672Z262_BCL2L1-      agga--catga-------------------gtgagctg-gttcctcggat
A0A672YCF8_BCL2L10      agaagggcacgaaaccggggctggaccctcaacaggtgcctggaaattac
A0A673A8P7_MCL1-01      agaaaggcagg-------------------gaaaactgtgtggagctggt
A0A673A8P7_MCL1-02      agaaaggcagg-------------------gaaaactgtgtggagctggt
A0A673A8P7_MCL1-03      agaaaggcagg-------------------gaaaactgtgtggagctggt
A0A673A8P7_MCL1-04      agaaaggcagg-------------------gaaaactgtgtggagctggt
A0A673BZP5_BCL2L1-      agga--gatga-------------------gtccactg-gtgggcaggat
                        ** *                                **  *         

A0A672Z262_BCL2L1-      cgccga-----ctggatgaccacgtac---ctggatgagcacatcagccc
A0A672YCF8_BCL2L10      aggggattggcagaaaccatagctgattacctgggagaggagaagaaaga
A0A673A8P7_MCL1-01      gggaga-----agagatttcagcatatctgctgtctgatca---gcgaga
A0A673A8P7_MCL1-02      gggaga-----agagatttcagcatatctgctgtctgatca---gcgaga
A0A673A8P7_MCL1-03      gggaga-----agagatttcagcatatctgctgtctgatca---gcgaga
A0A673A8P7_MCL1-04      gggaga-----agagatttcagcatatctgctgtctgatca---gcgaga
A0A673BZP5_BCL2L1-      cgtaga-----gtggatgacggtgtac---ctggataaccacattcaggg
                         *  **         *         *    ***    *  *         

A0A672Z262_BCL2L1-      atggattgagagcgcaggagg----ctgggacagcttcggtgagattttt
A0A672YCF8_BCL2L10      ctggctgc----tggagaatgatggctgggaggggttctgtaagttctcc
A0A673A8P7_MCL1-01      ctggctgc----tcaaaaacaactcctgggacggctttgtagagttcttc
A0A673A8P7_MCL1-02      ctggctgc----tcaaaaacaactcctgggacggctttgtagagttcttc
A0A673A8P7_MCL1-03      ctggctgc----tcaaaaacaactcctgggacggctttgtagagttcttc
A0A673A8P7_MCL1-04      ctggctgc----tcaaaaacaactcctgggacggctttgtagagttcttc
A0A673BZP5_BCL2L1-      ctggatccagagccaaggagga----tgggagcgctttgccgaaatcttt
                         *** *         *  *       *****  * **     *  * *  

A0A672Z262_BCL2L1-      ggacaaagcgcagctgccgaagcacggaggtctggggagacgctgaagcg
A0A672YCF8_BCL2L10      catca--------tgccaga---------------aaagtgagtcaggac
A0A673A8P7_MCL1-01      cg---------agtatcaga-----------cccagaa-----tcaaca-
A0A673A8P7_MCL1-02      cg---------agtatcaga-----------cccagaa-----tcaaca-
A0A673A8P7_MCL1-03      cg---------agtatcaga-----------cccagaa-----tcaaca-
A0A673A8P7_MCL1-04      cg---------agtatcaga-----------cccagaa-----tcaaca-
A0A673BZP5_BCL2L1-      ggccaggatgcagcggcagagggcaggaggtctcaggagagtttcaagaa
                                        * **                 *     * *    

A0A672Z262_BCL2L1-      atggctgctggtcggagtggtgttgttaactggag----------tgctg
A0A672YCF8_BCL2L10      tcgtcc----atgaagaaagctctgtttgctgctgctggggtcggcctcg
A0A673A8P7_MCL1-01      ----------gtgaggaacacactgatgaccgtggctggattagctggta
A0A673A8P7_MCL1-02      ----------gtgaggaacacactgatgaccgtggctggattagctggta
A0A673A8P7_MCL1-03      ----------gtgaggaacacactgatgaccgtggctggattagctggta
A0A673A8P7_MCL1-04      ----------gtgaggaacacactgatgaccgtggctggattagctggta
A0A673BZP5_BCL2L1-      gtggctgctggcggggatgacccttgtgaccgggg----------tcgtg
                                               *  *  * *  *               

A0A672Z262_BCL2L1-      atcggtgtgctcgttgctaaaaaac---agtaa
A0A672YCF8_BCL2L10      ctggactcacct-tcctcctggtgcgctag---
A0A673A8P7_MCL1-01      ttggggcaacac-tggccatgttaatcaggtga
A0A673A8P7_MCL1-02      ttggggcaacac-tggccatgttaatcaggtga
A0A673A8P7_MCL1-03      ttggggcaacac-tggccatgttaatcaggtga
A0A673A8P7_MCL1-04      ttggggcaacac-tggccatgttaatcaggtga
A0A673BZP5_BCL2L1-      gtggggtcactcattgcccagaaacgcctgtga
                         * *     *   *               *   

© 1998-2021Legal notice