Dataset for CDS BOK of Organism Erpetoichthys calabaricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4SAA5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BOK (length=636 residues).
atggagatgcttcgaagatcttcagtttttgcagcagaggtgatggaggcatttgatcgctcaccgactgacaaggaact
tgtttcccaagcaaaggcattgtgccgagactatataaactccaggcttaacaaagcaggacttggctggtccaagtcag
agcatgggctatctggagggtcgctcagggaggtctcctcagttcttttgtggctaggtgatgagctggaatatcttcga
ccaaatgtctaccgcaatgtagctcgtcagctcaacattaatgcaaccttggagaatgttgtttcggatgcatttcttgc
tgtagcaggagagatgtttgcaacaggcatcacatggggaaaagtggtctctctctatgctgtggcaggtggacttgctg
tggactgtgtacgacaaggtcagccagctattgtgcacactattgtggactgcctgggggagtttgtcagaaagacactt
agcccatggctgaagaagcgtggaggctgggcagatatcaagcaatgcgtagtcaacaacgaccccagtttccagtccca
ctggttagtgtccacagtatatacctgtgggcactttgtgaaggcactggtgctttacctcctcagagaacgctga
© 1998-2023Legal notice