Dataset for CDS BCL-2-like of organism Bubo bubo

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0EQC0_BCL2A1-      atg--------------------------------gaaactgctgagttc
A0A8C0FD84_MCL1-01      agg-------------------------------gagaactgtt----tt
A0A8C0FL84_BCL2L1-      atg-----tccag-------------cagtaaccgggagttagtga--tt
A0A8C0IE77_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgc--tg
                        * *                                  *  *  *    * 

A0A8C0EQC0_BCL2A1-      tattacgtttattac-----------------------------ttagct
A0A8C0FD84_MCL1-01      gacctggttttgtgtaa---cttggaaacgagctgt-tttggggctagcc
A0A8C0FL84_BCL2L1-      gactttgtttcctacaagctctcgcagaagggatacagctggagtcagct
A0A8C0IE77_BCL2-01      aagtacatccactataaactctcgcagaggggatacgactgg-----gct
                         *     *    *                                  ** 

A0A8C0EQC0_BCL2A1-      ------------caagatta-------------tctg-------------
A0A8C0FD84_MCL1-01      ------------tgaga---------------ctttg-------------
A0A8C0FL84_BCL2L1-      ggaggaggaggatgagaacagga-----ctgactttg-------------
A0A8C0IE77_BCL2-01      gccgg-------cgaggacagggcacccctgcctccgggtctctctcctc
                                      **                 *  *             

A0A8C0EQC0_BCL2A1-      ----------------------caatatgtgcttcaggagtcacatcttg
A0A8C0FD84_MCL1-01      -gggtggtggggctgagctcc-cggcctc-------ggggctcgtgctgg
A0A8C0FL84_BCL2L1-      cagtggaggacgccgagatggacggcgtcctcaacgggagcccctcctgg
A0A8C0IE77_BCL2-01      ctgctgctgctgctg-------cggtcgctgctgctgctgctgctgctgg
                                              *             *  *      ** *

A0A8C0EQC0_BCL2A1-      gaccagcc-----------------------------caaaccagggttg
A0A8C0FD84_MCL1-01      ggc---tgcttttggcatgt-----------------cacaccgcgtctg
A0A8C0FL84_BCL2L1-      cacccgcccgccagccacgtagtgaacggagccgccgtgcaccggagcag
A0A8C0IE77_BCL2-01      gact--tcctctgatcacactg-ggctggtgtctccgcaccccg----ag
                          *                                      **      *

A0A8C0EQC0_BCL2A1-      ct------------------------catgtcttgcgaaaca--------
A0A8C0FD84_MCL1-01      atcccagatc----------------agggtggtacctggca--------
A0A8C0FL84_BCL2L1-      cctcgaagtccatgaaatcgttcaagcggccgatgtgaggca--------
A0A8C0IE77_BCL2-01      ccccccggct----------------cggctgctgctagccacgtcgtcc
                                                         *      **        

A0A8C0EQC0_BCL2A1-      ------------------------ttgcatcttcgctgcaagatcaaacc
A0A8C0FD84_MCL1-01      --------------caggagggtggtgtctcat-----------------
A0A8C0FL84_BCL2L1-      ----ggcgctgagagaggcgggggatgagtttgagttgaggtacc-----
A0A8C0IE77_BCL2-01      acctcgccctgcgccaggcgggcgacgagttctcccgccgctacc-----
                                                  *  *                    

A0A8C0EQC0_BCL2A1-      gaggaggctctcagaccattcttggacaggattgatattacctctgtagc
A0A8C0FD84_MCL1-01      -------ctcttgcaggaatgcttcggaagctggaaat-----ccagaaa
A0A8C0FL84_BCL2L1-      -ggcgggctttcagcgacctcacttcccagctccacatcacccccggcac
A0A8C0IE77_BCL2-01      -agagggactttgcccaaatgtccggccagctgcacctgacgcccttcac
                                  *        *         * *  *  *     *      

A0A8C0EQC0_BCL2A1-      tgt-tgccaagagaattttcaatggtgtcatgcaagaaa--------aat
A0A8C0FD84_MCL1-01      g-------aggaagatctgcaatcagtatgtgaagtggctgcccacgtgt
A0A8C0FL84_BCL2L1-      ggcgtatcaga----gctttgagcaggtagtgaacgaac--------tct
A0A8C0IE77_BCL2-01      ggc----caggggccgcttcgtggcggtggtggaggagc--------tct
                                *        *            ** *               *

A0A8C0EQC0_BCL2A1-      ttgctgatggaaatactaactggggacgaattatgaccatatttacgttt
A0A8C0FD84_MCL1-01      tcagtgatggagtaacaaactggggtagagtggtgacgctcatctcgttt
A0A8C0FL84_BCL2L1-      tccgcgatggagt---gaactggggtcgcatcgtggctttcttctccttc
A0A8C0IE77_BCL2-01      tccgagacggggt---taactggggcaggattgtggccttcttcgagttt
                        *    ** **       ********  *  *  ** *  *  *    ** 

A0A8C0EQC0_BCL2A1-      ggaggtcttctcactaagaagcttcaagagcatggagttcagctcactgg
A0A8C0FD84_MCL1-01      ggtgcctttgttgcgaaa-cacctgaagagcataaa---------ccagg
A0A8C0FL84_BCL2L1-      gg------aggagccttg-tgcgtggagagcgttga---------caagg
A0A8C0IE77_BCL2-01      gg------cggtgtgatg-tgcgtggagagcgtcaa---------ccggg
                        **                   * *  ***** *  *            **

A0A8C0EQC0_BCL2A1-      agaggagaa---------ggagcagatttcttacttcatcacagagtaca
A0A8C0FD84_MCL1-01      agaagtgcatcagctcgctggcag-----------ggatcatcacggacg
A0A8C0FL84_BCL2L1-      aga--tgcgggtattggtgggacgcattgtatcttggatgaccatgtact
A0A8C0IE77_BCL2-01      aga--tgtctccccttgtagacagcatcgccgcctggatgaccgagtacc
                        ***   *            *                 ** *    * ** 

A0A8C0EQC0_BCL2A1-      taataaacaac---aaagccgaatggatagatgcaaacggtggctgggaa
A0A8C0FD84_MCL1-01      cgctcgtctcatcgaagcgcgagtggctaatgagccaaggaggctggg-a
A0A8C0FL84_BCL2L1-      tgaccgaccacctagatccc---tggatccaggagaatggcggatgggta
A0A8C0IE77_BCL2-01      tgaaccggcacctgcacaac---tggatccaggacaacggaggctggg-a
                                       *   *   *** *        * ** ** **** *

A0A8C0EQC0_BCL2A1-      aatggcttcctaacgaagtttgaaagaag-------------------at
A0A8C0FD84_MCL1-01      g--ggctttgtcgacttcttccgagtcga------ggacctggaaggcag
A0A8C0FL84_BCL2L1-      a--gaactcatctccctg-gtggggatgg----------ctgccagtgtc
A0A8C0IE77_BCL2-01      t--gccttcgtcgagttgtatggcaacagtatgaggcctttgtttgattt
                           *   *  *                                       

A0A8C0EQC0_BCL2A1-      cactactatctttctcaaaaattacagccat-------------attcat
A0A8C0FD84_MCL1-01      catcagaaatgtactgatggcgtttgcaggt-gtggctggactg----gg
A0A8C0FL84_BCL2L1-      ctcc-----ctcgctccaggctggcagcggtgccggtcaaaccggtgcgc
A0A8C0IE77_BCL2-01      ctcctggatctctctgaagactatcctgagt-ctggtt---ctggtg-gg
                        *            **               *                   

A0A8C0EQC0_BCL2A1-      agctg--------------ttttctccttattcagagagtactactga--
A0A8C0FD84_MCL1-01      agc--------------------gagcttggcctacatgatccggtga--
A0A8C0FL84_BCL2L1-      agctccctgcagtgtttattctagtgcctgtcctagaccttgcagggaga
A0A8C0IE77_BCL2-01      agctt------gcatcactcttggcgcttatctcggacat-------aag
                        ***                       * *                  *  

A0A8C0EQC0_BCL2A1-      ---
A0A8C0FD84_MCL1-01      ---
A0A8C0FL84_BCL2L1-      taa
A0A8C0IE77_BCL2-01      tag
                           

© 1998-2022Legal notice