Dataset for CDS BCL2L2 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3CRF8_BCL2L2-01      atggcgaccccagcctccgccccagacaca-cgggctctggtggcagact
U3CRF8_BCL2L2-02      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
U3CRF8_BCL2L2-03      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
                      ****** *  * **  * **  ***   ** ****  ***  *** * * 

U3CRF8_BCL2L2-01      ttgtaggttataagctgaggcagaaaggttatgtctgtggaactggcccc
U3CRF8_BCL2L2-02      ---ggggctccgggccggggcggcggcgccatct-tgtgcccggggccgg
U3CRF8_BCL2L2-03      ---ggggctccgggccggggcggcggcgccatct-tgtgcccggggccgg
                           ** *    ** * *** *    *  ** * ****     ****  

U3CRF8_BCL2L2-01      ggggagggcccagcagctgaccc---gctgcaccaagcaatgcgggca--
U3CRF8_BCL2L2-02      tggggaggccggggagggggccccggggggcgcaggggactacgggaacg
U3CRF8_BCL2L2-03      tggggaggccggggagggggccccggggggcgcaggggactacgggaacg
                       ***  ****  * **  * ***   *  ** *   * * * **** *  

U3CRF8_BCL2L2-01      -gctgga----gatgaattcgagacccgcttccggcgcaccttctctgat
U3CRF8_BCL2L2-02      gcctggagtctgaggaactggag--------cctgaggagctgct----g
U3CRF8_BCL2L2-03      gcctggagtctgaggaactggag--------cctgaggagctgct----g
                        *****    ** *** * ***        ** * * * ** **     

U3CRF8_BCL2L2-01      ctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcac
U3CRF8_BCL2L2-02      ctggagcccgagccg-----gagcccg-----agcctgaagaggagccgc
U3CRF8_BCL2L2-03      ctggagcccgagccg-----gagcccg-----agcctgaagaggagccgc
                      **** * *  *** *     ** ***      ****  *  * *   * *

U3CRF8_BCL2L2-01      ccaggtctccgatgaacttttccaagggggtcccaactggggccgccttg
U3CRF8_BCL2L2-02      cccggcccc------gcgcccccccgggagctccgg--------gccctg
U3CRF8_BCL2L2-03      cccggcccc------gcgcccccccgggagctccgg--------gccctg
                      ** ** * *       *    **  *** *  **          *** **

U3CRF8_BCL2L2-01      tagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaag
U3CRF8_BCL2L2-02      -ggcctggttcg-----ggagc--ccccggcagtcaagag-------gag
U3CRF8_BCL2L2-03      -ggcctggttcg-----ggagc--ccccggcagtcaagag-------gag
                        ****  ** *     ** **  * * *   *   ****        **

U3CRF8_BCL2L2-01      gagatggaaccactggtgggacaagtgcaggagtggatggtggcctacct
U3CRF8_BCL2L2-02      gaggaggagcc------gggac--------tggtcgagggtgac---ccg
U3CRF8_BCL2L2-03      gaggaggagcc------gggac--------tggtcgagggtgac---ccg
                      ***  *** **      *****          ** ** **** *   ** 

U3CRF8_BCL2L2-01      ggagacgcggctggccgactggatccacagcagtgggggctgggagctgg
U3CRF8_BCL2L2-02      ggggacggcgc-------------------cattgaggacccggagctgg
U3CRF8_BCL2L2-03      ggggacggcgc-------------------cattgaggacccggagctgg
                      ** ****  **                   ** ** ** *  ********

U3CRF8_BCL2L2-01      aagctatcaaagctcgagtcagggagatggaggaagaagctgagaagcta
U3CRF8_BCL2L2-02      aagctatcaaagctcgagtcagggagatggaggaagaagctgagaagcta
U3CRF8_BCL2L2-03      aagctatcaaagctcgagtcagggagatggaggaagaagctgagaagcta

U3CRF8_BCL2L2-01      aaggaactacagaacgaggtagagaagcagatgaatatgagtccacctcc
U3CRF8_BCL2L2-02      aaggaactacagaacgaggtagagaagcagatgaatatgagtccacctcc
U3CRF8_BCL2L2-03      aaggaactacagaacgaggtagagaagcagatgaatatgagtccacctcc

U3CRF8_BCL2L2-01      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
U3CRF8_BCL2L2-02      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg
U3CRF8_BCL2L2-03      aggcaatgctggcccagtgatcatgtccattgaggagaagatggaggctg

U3CRF8_BCL2L2-01      atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaa
U3CRF8_BCL2L2-02      atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaa
U3CRF8_BCL2L2-03      atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaa

U3CRF8_BCL2L2-01      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
U3CRF8_BCL2L2-02      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
U3CRF8_BCL2L2-03      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat

U3CRF8_BCL2L2-01      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
U3CRF8_BCL2L2-02      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
U3CRF8_BCL2L2-03      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt

U3CRF8_BCL2L2-01      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
U3CRF8_BCL2L2-02      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
U3CRF8_BCL2L2-03      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta

U3CRF8_BCL2L2-01      tttagaggaaggcagatcaaggtgatcccaaaacgaaccaacagaccagg
U3CRF8_BCL2L2-02      tttagaggaaggcagatcaaggtgatcccaaaacgaaccaacagaccagg
U3CRF8_BCL2L2-03      tttagaggaaggcagatcaaggtgatcccaaaacgaaccaacagaccagg

U3CRF8_BCL2L2-01      catcagcacaacagaccggggttttccacgagcccgctaccgcgcacgga
U3CRF8_BCL2L2-02      catcagcacaacagaccggggttttccacgagcccgctaccgcgcacgga
U3CRF8_BCL2L2-03      catcagcacaacagaccggggttttccacgagcccgctaccgcgcacgga

U3CRF8_BCL2L2-01      ccaccaactacaacagttcccgctctcgattctacagtggttttaacagc
U3CRF8_BCL2L2-02      ccaccaactacaacagttcccgctctcgattctacagtggttttaacagc
U3CRF8_BCL2L2-03      ccaccaactacaacagttcccgctctcgattctacagtggttttaacagc

U3CRF8_BCL2L2-01      aggccccggggtcgcgtctacaggggccgggctagagcgacatcatggta
U3CRF8_BCL2L2-02      aggccccggggtcgcgtctacaggggccgggctagagcgacatcatggta
U3CRF8_BCL2L2-03      aggccccggggtcgcgtctaca--ggtcaggatag---------------
                      **********************  ** * ** ***               

U3CRF8_BCL2L2-01      ttccccttactaa
U3CRF8_BCL2L2-02      ttccccttactaa
U3CRF8_BCL2L2-03      -------------

© 1998-2023Legal notice