Dataset for CDS BAK1 of Organism Eptatretus burgeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4N758_BAK1-01      --------------------------------------------------
A0A8C4N758_BAK1-02      atgaagaagcgcaaaaaggcgcgaagccggaagaagcctcgccgaagggc
A0A8C4N758_BAK1-03      --------------------------------------------------
                                                                          

A0A8C4N758_BAK1-01      --------------------------------------------------
A0A8C4N758_BAK1-02      gtgtccgatgacgtcacgcaaagaaagcccaaagggttcgttacttccgg
A0A8C4N758_BAK1-03      --------------------------------------------------
                                                                          

A0A8C4N758_BAK1-01      --------------------------------------atggccagcgga
A0A8C4N758_BAK1-02      gaatttcagtcaccctcgaaccgccgtccattctcgtgatggccagcgga
A0A8C4N758_BAK1-03      --------------------------------------atggccagcgga
                                                              ************

A0A8C4N758_BAK1-01      gacgacacaaaccttccctcggataaatcttccccttcatctcccgggag
A0A8C4N758_BAK1-02      gacgacacaaaccttccctcggataaatcttccccttcatctcccgggag
A0A8C4N758_BAK1-03      gacgacacaaaccttccctcggataaatcttccccttcatctcccgggag
                        **************************************************

A0A8C4N758_BAK1-01      aactcctcgctcctctccgactgaggattcagtggttgcagatgccgagg
A0A8C4N758_BAK1-02      aactcctcgctcctctccgactgaggattcagtggttgcagatgccgagg
A0A8C4N758_BAK1-03      aactcctcgctcctctccgactgaggattcagtggttgcagatgccgagg
                        **************************************************

A0A8C4N758_BAK1-01      cagtgtttcgcagctacgtatattgccgtgttgaacaggatgaggctcat
A0A8C4N758_BAK1-02      cagtgtttcgcagctacgtatattgccgtgttgaacaggatgaggctcat
A0A8C4N758_BAK1-03      cagtgtttcgcagctacgtatattgccgtgttgaacaggatgaggctcat
                        **************************************************

A0A8C4N758_BAK1-01      gctgcagagcaagagggcagtgcagtcggagcaatggtagctccgggggc
A0A8C4N758_BAK1-02      gctgcagagcaagagggcagtgcagtcggagcaatggtagctccgggggc
A0A8C4N758_BAK1-03      gctgcagagcaagagggcagtgcagtcggagcaatggtagctccgggggc
                        **************************************************

A0A8C4N758_BAK1-01      agcctgtttgacacctgccatgtctgagatttttgggattcaggactcac
A0A8C4N758_BAK1-02      agcctgtttgacacctgccatgtctgagatttttgggattcaggactcac
A0A8C4N758_BAK1-03      agcctgtttgacacctgccatgtctgagatttttgggattcaggactcac
                        **************************************************

A0A8C4N758_BAK1-01      ctctcagtcctacggcccaggttggacgacagttggcgacaatcggcgat
A0A8C4N758_BAK1-02      ctctcagtcctacggcccaggttggacgacagttggcgacaatcggcgat
A0A8C4N758_BAK1-03      ctctcagtcctacggcccaggttggacgacagttggcgacaatcggcgat
                        **************************************************

A0A8C4N758_BAK1-01      gaaattacccggcgttacgatagacagttccagcagttcctgtgcagtct
A0A8C4N758_BAK1-02      gaaattacccggcgttacgatagacagttccagcagttcctgtgcagtct
A0A8C4N758_BAK1-03      gaaattacccggcgttacgatagacagttccagcagttcctgtgcagtct
                        **************************************************

A0A8C4N758_BAK1-01      ccaaatcacacaggaaaacgcgtacgacgtcttccgggagatagcgatga
A0A8C4N758_BAK1-02      ccaaatcacacaggaaaacgcgtacgacgtcttccgggagatagcgatga
A0A8C4N758_BAK1-03      ccaaatcacacaggaaaacgcgtacgacgtcttccgggagatagcgatga
                        **************************************************

A0A8C4N758_BAK1-01      gcctcattcaggatggagtgaactggggacgtattctggcgttgttagct
A0A8C4N758_BAK1-02      gcctcattcaggatggagtgaactggggacgtattctggcgttgttagct
A0A8C4N758_BAK1-03      gcctcattcaggatggagtgaactggggacgtattctggcgttgttagct
                        **************************************************

A0A8C4N758_BAK1-01      tttggctaccgcatggcaatccatgtgttcagcaaaggttggcacggttt
A0A8C4N758_BAK1-02      tttggctaccgcatggcaatccatgtgttcagcaaaggttggcacggttt
A0A8C4N758_BAK1-03      tttggctaccgcatggcaatccatgtgttcagcaaaggttggcacggttt
                        **************************************************

A0A8C4N758_BAK1-01      ctttcgccagattacttccttcttctgtcgcttcatcctgcagaacaaca
A0A8C4N758_BAK1-02      ctttcgccagattacttccttcttctgtcgcttcatcctgcagaacaaca
A0A8C4N758_BAK1-03      ctttcgccagattacttccttcttctgtcgcttcatcctgcagaacaaca
                        **************************************************

A0A8C4N758_BAK1-01      tcgctaagtggattgctgagcacggaggctgggtgagattaccaaggggc
A0A8C4N758_BAK1-02      tcgctaagtggattgctgagcacggaggctgggtgagattaccaaggggc
A0A8C4N758_BAK1-03      tcgctaagtggattgctgagcacggaggctg-----gaatgc--------
                        *******************************     ** * *        

A0A8C4N758_BAK1-01      acgtgctacatctccaaatccctgtgcaccgtaacaaactattca-tgcc
A0A8C4N758_BAK1-02      acgtgctacatctccaaatccctgtgcaccgtaacaaactattca-tgcc
A0A8C4N758_BAK1-03      -tgtgctgcagttgaaaaaccctttcttctggg------tatttgctgcc
                          ***** **  *  *** **** *   * *        ****   ****

A0A8C4N758_BAK1-01      agcaattttgttccatgcgttggtctctagcatttaacgctcaaccctta
A0A8C4N758_BAK1-02      agcaattttgttccatgcgttggtctctagcatttaacgctcaaccctta
A0A8C4N758_BAK1-03      tccttcattgt----tacgctcttctc-agca-atgatgctgaa-----a
                          *    ****    * ** *  **** ****  * * *** **     *

A0A8C4N758_BAK1-01      tccttctaa
A0A8C4N758_BAK1-02      tccttctaa
A0A8C4N758_BAK1-03      cggtcttga
                           *  * *

© 1998-2023Legal notice