Dataset for CDS BCL-2-like of organism Cyanoderma ruficeps

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3NVU4_BCL2A1-      atg--------------------------------gaaactgctgagttt
A0A8C3QX54_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgc--tg
A0A8C3QRB8_MCL1-01      atg-----ttcgc-------------cgtgaagccgaaagccgtca--tc
A0A8C3XCF2_BCL2L1-      atg-----tacag-------------cagtaaccgggagttagtga--tt
                        ***                                * *     *    * 

A0A8C3NVU4_BCL2A1-      tattacgtttattac-------------------ttagctcaggattatc
A0A8C3QX54_BCL2-01      aagtacatccactat--------------------aaactctcacaga--
A0A8C3QRB8_MCL1-01      ggcttcaacctctactgcggcggcgccccggcgctgagccccggcgggcc
A0A8C3XCF2_BCL2L1-      gactttgtttcctac--------------------aagctctcacaga--
                           *        **                      * * *         

A0A8C3NVU4_BCL2A1-      tgcaatatgt----------gctccaggaatcgcacctcggaccagccc-
A0A8C3QX54_BCL2-01      ggggatacgactggg-----ctgccggtgaggacagggcacccctgcctc
A0A8C3QRB8_MCL1-01      cggggagcgcccggagcccgccgccgccgccggcgcctcagagcagcccc
A0A8C3XCF2_BCL2L1-      aaggatacagctggagc---cagctggaggaggaagatgagaacaggac-
                                               *                   * *    

A0A8C3NVU4_BCL2A1-      ---------------------------agaccagggttgctcgtgtctt-
A0A8C3QX54_BCL2-01      caggtctctctgttcctgctgctgctgctgctgggacttcctctgatcac
A0A8C3QRB8_MCL1-01      gcgaccgctccggggccgcccccgcccgcgccgagccgccccgcgcgctg
A0A8C3XCF2_BCL2L1-      -tgactttgcaggggagg---------aggacgaggtggatggcgtcctc
                                                          *         *     

A0A8C3NVU4_BCL2A1-      -------gcgaaccatcgcatcttcc------------------------
A0A8C3QX54_BCL2-01      actgggctggtgtctccgcaccccgagcccc-------------------
A0A8C3QRB8_MCL1-01      attgg--ctgcggcgccgcgccccgcgcgctgattggctgcggcgcgact
A0A8C3XCF2_BCL2L1-      aatgg------------gagcccctc------------------------
                                         *   *                            

A0A8C3NVU4_BCL2A1-      -----------------------------ctgcaagaccaaa--------
A0A8C3QX54_BCL2-01      --ccggctc---------------ggctgctgctagcca-----------
A0A8C3QRB8_MCL1-01      ctctggcgccccgaggaggagctggacggctgcgagcccgagcccgagcg
A0A8C3XCF2_BCL2L1-      --ctggcac----------------gcgcctaccagccacatagtgaacg
                                                     ** * ** *            

A0A8C3NVU4_BCL2A1-      --------------------------------------------ccgagg
A0A8C3QX54_BCL2-01      -----------------cgcgcccccgg----------------ccgagg
A0A8C3QRB8_MCL1-01      cggccccgccgccgactcgctgcccgggacccccccggggccccccgacg
A0A8C3XCF2_BCL2L1-      gagccac----------cgtgcaccagagcagcctcgaagtcc----acg
                                                                       * *

A0A8C3NVU4_BCL2A1-      aggctc---------------------tcaggccactcctg---------
A0A8C3QX54_BCL2-01      ggctgcgccccg---caccccaggtcgtgcacctcgtcctgcgcca----
A0A8C3QRB8_MCL1-01      ggctccggcaggactcgctggagctcatcagccgctacctgcgggaagtg
A0A8C3XCF2_BCL2L1-      agatccgtcgag----------------cagccg--acgtgaggcaggcg
                         *   *                          *    * **         

A0A8C3NVU4_BCL2A1-      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      gcgggcgaggcggagcccgcatccaagaaacttttcccggggctcctggg
A0A8C3XCF2_BCL2L1-      ctgagaga------------------------------------------
                                                                          

A0A8C3NVU4_BCL2A1-      ---------------------gacagga----------------------
A0A8C3QX54_BCL2-01      ---------------------ggcaggggatgagttc----------tcc
A0A8C3QRB8_MCL1-01      tggtcccggccggcccggcgcggcgggggatgcggtgatggagaaagcgc
A0A8C3XCF2_BCL2L1-      ---------------------ggcgggggatgagttt---------gagc
                                             * * **                       

A0A8C3NVU4_BCL2A1-      -----------------------------------------------ttg
A0A8C3QX54_BCL2-01      cgacgctaccagagggactttgcccagatgt----------------ctg
A0A8C3QRB8_MCL1-01      tggagacgctgcggagaatcggcgacggcgtcatgcggaaacacgagctc
A0A8C3XCF2_BCL2L1-      tgaggtaccggcgggcgttcagcgac---------------------ctc
                                                                        * 

A0A8C3NVU4_BCL2A1-      acatcac---------------ctctgtagctgttgccaag---------
A0A8C3QX54_BCL2-01      gcc-------------------agctgcacctgacgcccttcacggccag
A0A8C3QRB8_MCL1-01      gcctttcaagggatgctgcggaagctgcaaat-----ccagcaagagg--
A0A8C3XCF2_BCL2L1-      acttccc---------------agctccacatcactcccagcacagcgta
                         *                      **  *  *     *            

A0A8C3NVU4_BCL2A1-      --agaattttcaatggagtcatgga---------agaaaagttttctgat
A0A8C3QX54_BCL2-01      gagccgcttcgtagcc-gtggtgga---------agagctcttccgagat
A0A8C3QRB8_MCL1-01      --aggacctgcagtcg-gtggtggaggtggctgcccacctcttcagcgac
A0A8C3XCF2_BCL2L1-      tcagagctttgagcag-gtagtgaa---------cgaactgttccgcgat
                                *        **  ** *           *    **    ** 

A0A8C3NVU4_BCL2A1-      ggaaatactaactggggacgaatcatgaccatatttacatttggaggtct
A0A8C3QX54_BCL2-01      ggggtt---aactggggcagaattgtggccttcttcgagtttggc-----
A0A8C3QRB8_MCL1-01      ggggtgaccaactggggccgcgtggtgacgctcatctccttcggggcctt
A0A8C3XCF2_BCL2L1-      ggagtg---aactggggccgcatcgtggctttcttctccttcgga-----
                        **       ********  *  *  ** *  *  *    ** **      

A0A8C3NVU4_BCL2A1-      tctcaccaagaagcttcaagagcatggggttcagctgactgcagaggaga
A0A8C3QX54_BCL2-01      -ggtgtcatg-tgcgtggagagcgt--------------caaccgggaga
A0A8C3QRB8_MCL1-01      cgtggccaag-cacctgaagagc-----------------atcaagcagg
A0A8C3XCF2_BCL2L1-      -ggagccttg-tgcgtggagagcgt--------------tgttaaggaga
                              *  *   * *  *****                      * ** 

A0A8C3NVU4_BCL2A1-      aggagg------------agatctcttatttcatcacagagtacatcata
A0A8C3QX54_BCL2-01      tgtctcccctcgtggacagcatcgctgcctggatgactgagtacctgaac
A0A8C3QRB8_MCL1-01      agcaga------------gcatcagctccc---tggccgggatcatcacc
A0A8C3XCF2_BCL2L1-      tgcgggtattggtgaaacgcatcgtgtcttggatgaccacgtacttgacc
                         *                  ***          *  *   *  * * *  

A0A8C3NVU4_BCL2A1-      aacaacaaatctgaatggattgatgca----------------aacggtg
A0A8C3QX54_BCL2-01      cggcac----ctgcacaactggatccaggac------------aacggag
A0A8C3QRB8_MCL1-01      gacgcc----ctggtctcgtccaagcgggagtggctggagagccaggggg
A0A8C3XCF2_BCL2L1-      gaccac----ttagatccctggatccaggag------------aatggcg
                             *     *       *  *  *                  * ** *

A0A8C3NVU4_BCL2A1-      gctgggaaaatggcttcct-------------aacaaagt-----ttgaa
A0A8C3QX54_BCL2-01      gctggg---atgcctttgtggagttgtatggcaacagtat----------
A0A8C3QRB8_MCL1-01      gctggg---agggctttgtggactt-----------------cttccgag
A0A8C3XCF2_BCL2L1-      gatggg---agcgctttgtggacctctatgggaacaatgctgctgccgag
                        * ****   *   ***  *                               

A0A8C3NVU4_BCL2A1-      agaagatcactactgtctttctccaaaattacagccctg-------ttga
A0A8C3QX54_BCL2-01      -----------gaggcctttgttcgattt----ctcctggatctctctga
A0A8C3QRB8_MCL1-01      tggaggacctggagggcagcatccggaac----gt---g-------ctga
A0A8C3XCF2_BCL2L1-      gtgagaa----aaggtcaa-----gaaac----cttcaa-------caaa
                                      * *                                *

A0A8C3NVU4_BCL2A1-      tagctgttg-------cttccttgttcagagagtactac-----------
A0A8C3QX54_BCL2-01      agactatcc-tgagtctggttctggtgggagcttgcatcactcttggcgc
A0A8C3QRB8_MCL1-01      tggcctttg-caggggtggc--tggcctggg--ggc--cagcttgg---c
A0A8C3XCF2_BCL2L1-      tggctcctgaccggggcgacggtggccggag--tgcttctgctgggatcc
                           *                  **    * *    *  *           

A0A8C3NVU4_BCL2A1-      ----------------tga
A0A8C3QX54_BCL2-01      ttatctcggacataagtag
A0A8C3QRB8_MCL1-01      ctacatgatccg---gtga
A0A8C3XCF2_BCL2L1-      ctgc-tgagccgcaagtga
                                        *  

© 1998-2022Legal notice