Dataset for CDS Unclassified of organism Medioppia subpectinata

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7R9Q6U3_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Medioppia subpectinata (length=654 residues).
atggcgaccaatggctcatccaatgtgtctgaagtgcgaaccaatggtcacaaccgaacggattgttcgcttcagtcgat
agtcaatgagttcttgtgttcacaattggctcttaagggttacaactggtctccagaagtggtggccaacggtgtccaca
acgcggccgacgactcccataacaaccaatcgtttaattcgagtcaaaggactaaaatagtggacgcgttgaagacattg
ggccacaaatacgtgcgtttatatgagggccagttgtcggcgatgtgtgagcgcctggagttgagtccgtcgacagcgat
gaccactttcaacagtgtgtccaacgagttgttcatcgaagggatcaaatggaatcatatcatcactttcctggtcttcg
gctctgagttcgcattcagttgcgttcaaaacggtttcccaaatctagtgaatgaagtctcccattggatcaccgcttat
gtcacgacacacctgagccaatggatccgtgataacggggactgggaatatgtgattgagttttcgggcgagaaagtggt
tgagggacagaaaaaactgctttacggagcggccggtgctctcggagtcctcactctgggcttatttctccgaaactttt
catttttcaaataa
© 1998-2022Legal notice