Dataset for CDS Unclassified of organism Equus caballus

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A5F5PUY3_uncBCL2A1-03 Putative BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus (length=636 residues).
atgaccgactgtattctcatcaagaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttctta
ctttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagt
atcaaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttc
caacaaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctga
ggaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaa
cagggggacttgatctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctac
tatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaat
ttgtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PUY3_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus (length=693 residues).
atggaaaagcaatttgaagatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaa
gaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacga
aaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttcc
atctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttat
cccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
catcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctc
atgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctg
tctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacg
aaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PUY3_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus (length=696 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcaa
tagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatc
agcctggtgaggaggaggttcgggaggaggccttgtcaacagcagcctggagatga
>gnl|bcl2dbcds|A0A5F5PUY3_uncBCL2A1-05 Putative BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus (length=612 residues).
atggcggcggcagctgtgagtggtgctaagcggcgcctgcgggccgagctgaagcagcgtctgcgggcgatgagcgccga
ggaacggctacgccagtctcgcctcttgactcagaaggtgattgcccacagtcagtatcaaaaatccaaaaggatttcca
tctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatc
ccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaac
atcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctca
tgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctgt
ctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacga
aaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PUY3_uncBCL2A1-04 Putative BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactactga
© 1998-2020Legal notice