Dataset for CDS Unclassified of organism Bos indicus

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A4W2CHX7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos indicus (length=702 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggatacaactgcagtcaatt
taatgatatatggaaaccaaccccaaatgccatcaatgacaacccaccttggcacctggcagatagccctgtggtgaatg
gagccactggccacagcagaagcttggacgcccagaaagtgatccccatgacaacagtaaagcaaaccctgagggagaca
gataaccagtttgaactgaggtaccaacagacattcagcgacctgacgtcccagctccacatcaccacagggacagcata
tcagagctttgaacagaatggcggctgggactcttttgtgaaactctatgaaaacaatacagcaaccaagagccaaaagg
gccaggaccgttccaaccactggtccctgatgggcatgactttggctggtatagctctgctgggctcgcttttcactcac
agtaactattcccctcattataatcattcatattttatacaagcttgtgttcctcttccttttgttatagctatagagaa
cttacagtttaataagactctacgttttgtgacttgtatagattacaaaatgtgtacttgtcttaattcctctgtttctt
tgaaaaatgaatccctggaaagagggtcccatggcagaacttgcctctcggctactcactaa
>gnl|bcl2dbcds|A0A4W2E8M1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos indicus (length=522 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccccagaagggacagaatcagatatggaaatccccagtgccatcaatggca
acccatcctggcatgtggcagatagccctgcagtgaatggagccattggccacagcagaagcttggacgcccggaaaatg
atccctatgacaacagtaaagcaagccgtgagggaggcaagcaatgagtttgaactgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgaacaggagaatggtgactgggacacttttg
tggaactctacgaaaacaatacaacagagagccaaaagagtcaagagagcttcaactgctggtccctgatggacgtgagt
gtggctggtgtggttccactgggcttgctcttcaactcataa
>gnl|bcl2dbcds|A0A4W2FHS8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos indicus (length=522 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccccagaagggacagaatcagatatggaaatccccagtgccatcaatggca
acccatcctggcatgtggcagatagccctgcagtgaatggagccattggccacagcagaagcttggacgcccggaaaatg
atccctatgacaacagtaaagcaagccctgagggaggcaagcaatgagtttgaactgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgaacaggagaatggtgactgggacacttttg
tggaactctacgaaaacaatacaacagagagccaaaagagtcaagagagcttcaactgctggtccctgatggacgtgagt
gtggctggtgtggttccactgggcttgctcttcaactcataa
>gnl|bcl2dbcds|A0A4W2FL65_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos indicus (length=567 residues).
ttggaatccagaaaatatttttcttgctatatatggaaaccaaccccaaatgccatcaatgacaacccaccttggcacct
ggcagatagccctgcagtgaatggagccactggccacagcagaagcttggacgcccagaaagtgatccccatgacaacag
taaagcaaaccctgagggagacagacaaccagtttgaactgaggtaccaacagacattcagcaacctgacgtcccagctc
cacatcaccacagggacagcatatcagagctttgaacaggtaatgtatgaactcttctgggccggggtaaactggggtca
catggcctttttttcctttggtgggacactgcatagaaatcaaatcccaacttggatggccacttacctaaatgaccacc
tagagccttggatccaggagaatggcggctgggactcttttgtgaaactctatgaaaacaatacagcaaccaagagccaa
aagggccaggaccgttccaaccactggtccctgatgggcatgactttggctggtatagctctgctgggctcgcttttcaa
ctcatag
>gnl|bcl2dbcds|A0A4W2H7Y7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos indicus (length=588 residues).
atctttattatgaaaatgtctcagagcaaccgacggctggtggttgactttctctcttacaagctttcccagaaaggata
cagctggagtcgatttaatgatgtggaagagaacagaactgaggcctcggaagggacaaaatcagatatggaaaccccaa
tgccatcaatgacaacccatcttggcacctggaggatagcattcagcgaccagacatcccagctccacatcaccccgggg
acagcatatcagagctttgaacagatgatgtatgaactcctccaggacggggtgaactggggtcgcattgtggccttttt
ttccttcggtggggcactatgcatggaaagcatagacaaggagacacaagtattggtgagtcaaagcacaacttggatgg
ccacctacctaaatgaccacctagagtcttggatccaggagaacggcggctgggacacttctgtgaaactctgtgaaaac
aatacaaccaccgagagccaaaagggccaggagcgcttcaacagctggtccctgacgggcatgacttcggctggtacagc
tctgctgggcttgctactcaactcatag
© 1998-2020Legal notice