Dataset for CDS BCL2L2 of organism Bos indicus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1098 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctggttctcccagaccagtgaagctgagatggttcatgaagtatttttcggt
gaaattttaagcaactgtgactctgctccaagttctcctgttcctgaggagctggaagcgatcaaagctcgagttaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatt
tagtggccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaat
ccttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttc
ccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=972 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1011 residues).
atgggaacggttctcttttctgggcacccactccagggctggaagagttcaacaagtgcatggaacgtcagagaccttct
ggaaatgctgaatttactccaaggtttcatgaggcccagccggcttctcttcacagcctccagggtcagaagccctgcct
ggcccttgatgccctcctggccctgttcttcctggcctccagcagccctcttctttcctgagttgtggctcttcccaagc
ctgcgtcccagccccgcccctctctctggacgcatctctgggccccatcatcacccggcgccgggccctccctcccgccc
cccctttctcctccctccttccttccctcccttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
atcccggcagcggcctgacccccgcccggatggcgaccccagcctcggccccagacacacgggctctagtggcagacttt
gtgggctataagctgaggcagaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacacca
agccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtga
ccccgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaactggggccgccttgtg
gccttctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcagga
gtggatggtggcctacctggagacgaggctggctgactggatccacagcagtgggggctgggcggagttcacagctctat
acggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggct
gtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2020Legal notice