Dataset for CDS BAX of Organism Equus asinus asinus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C4L686_BAX-01 BCL2-associated X gene OS=[Eukaryota] Equus asinus asinus GN=BAX (length=594 residues).
atggacgggtccggggagcaacccagaggcgggggtgaggatcgcgcggggcggatggggggagacacacccgagctggg
cctggaggaggtgccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgagctggacagta
acatggagctgcagaggatgattgcggccgtggacacggactccccccgcgaggtctttttccgagtggcagctgagatg
ttttccgacggcaacttcaactggggccgggttgttgcccttttctactttgccagcaaattggtgctcaaggccctgtg
caccaaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatcc
aggaccagggtggttgggtgaggcctctgggacccctgagcccaccaccgagacggcctcctctccgactttgggtcacc
cacgtggcagacagtgaccatcttcgtggccggagtgctcaccgcctcgctcaccatctggaagaagatgggctgaggcc
accagctgccttggactgtgactcttctgcataa
>gnl|bcl2dbcds|A0A8C4L686_BAX-02 BCL2-associated X gene OS=[Eukaryota] Equus asinus asinus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgcgcggggcggatggggggagacacacccgagctgggcctggaggaggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggagatgagctggacagtaacatggagctgcagaggatgatt
gcggccgtggacacggactccccccgcgaggtctttttccgagtggcagctgagatgttttccgacggcaacttcaactg
gggccgggttgttgcccttttctactttgccagcaaattggtgctcaaggccctgtgcaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctccgactttgggtcacccacgtggcagacagtgaccatcttcgtggccggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2023Legal notice