Dataset for CDS BAK1 of Organism Equus asinus asinus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C4MQG4_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Equus asinus asinus GN=BAK1 (length=636 residues).
atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcctccacttctgaggagcaggt
agcccgggacacggaggaggttttccgcagctacgtttattaccgccaccagcaggagcaggaggccgagggggcggctg
cgcccgcagacccagagatggacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccgtc
atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctgcagccgacagcagagaacgc
ctatgagctgttcaccaagatcgcctcgagcctgtttgagagcggcatcaactggggccgagtggtggctctcctggggt
tcggctaccgcctggccctgcatgtctaccagcgcggcctgaccggcttcctgagccagttgacccgcttcgtggctgaa
ttcatgctgcatcactgcattgcccggtggatcgcacagaggggcggctgggtggcggctctggacttgggaaatggccc
catccggaatgtgctgatagttctggctgtggttctgttgggccagtatgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|A0A8C4MQG4_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Equus asinus asinus GN=BAK1 (length=462 residues).
atggcgtccgggcaaggcccaggtcctccggggaaggagtgcggagagcctgccccgtcctccacttctgaggagcaggt
agcccgggacacggaggaggttttccgcagctacgtttattaccgccaccagcaggagcaggaggccgagggggcggctg
cgcccgcagacccagagatggacaccctgcccctggaacctaacagcaccatggggcaggtggggcggcagctcgccgtc
atcggggacgacatcaatcggcgctacgactcggagttccagaccatgctgaagcacctgcagccgacagcagagaacgc
ctatgagctgttcaccaagatcgcctcgaggccagcagcaacacccacagcctgtttgagagcggcatcaactggggccg
agtggtggctctcctggggttcggctaccgcctggccctgcatgtctaccagcgcggcctga
© 1998-2023Legal notice