Dataset for CDS Unclassified of Organism Canis lupus familiaris

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|J9NV03_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Canis lupus familiaris (length=924 residues).
atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcgcggggacggcggcggccggtggcctccgga
gctgcgccgggaactcgctcgggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctccgccccgggg
gctgccttttccttagaaggcgaagccccaagcctcgcctcccgcccgcggagcccgcgccccgcgccccgcgcccctcg
ccgccgccccagggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggcgacgggcgggcgcgtcctca
tcgctcgggacggacacccgaggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtgccgcgcccc
tggcccgcgtccccgccatggaggtgctgcggcgctcctcggtcctcgccgcggagatcatggacgcctttgaccgctcg
cccagcgacaaggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgcggctgctgcgcgccggcct
ggcctggaccgcgcccgagcgcgccgctcccgcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctgg
gtgagtgcggggaggccccgagagggagagggcgagggcgagggcgagggcgagggcgagggcgagggcgagggccgggg
ctggggtcagcctgcagggcaccccccgcccctccctgcccccaggcccctgcccgcgggcccagcccccgcgatgcctg
cggggcccagattccaggcggaaggctagactcccgagtgacccttgtactgagctgggcacaggaaccctttgtgggac
cacgtgtccccatgtttgttttggaaagtctgtctcctgcctga
© 1998-2020Legal notice