Dataset for CDS BAX of Organism Bos indicus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A4W2CIX3_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos indicus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|A0A4W2CIX3_BAX-02 BCL2-associated X gene OS=[Eukaryota] Bos indicus GN=BAX (length=432 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgatcgcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacg
gcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtg
cccgagttgatcaggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccg
cctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A4W2H091_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos indicus GN=BAX (length=543 residues).
atgagaccccattctgattctgtatccccgcaactccgttcccaccctagtttcatccaggatcgagcagggcgaatggg
gggagagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgca
tcggagatgaattggacagtaacatggagctgcagaggatgatcgcagctgtggacacagactctccccgagaggtcttt
ttccgagtggcggctgaaatgttttctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaa
actggtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattggacttccttcgag
agcggctgctgggctggatccaggaccagggtggttgggacggcctcctctcctactttgggacacccacatggcagaca
gtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|A0A4W2H091_BAX-02 BCL2-associated X gene OS=[Eukaryota] Bos indicus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttctgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
© 1998-2023Legal notice