Dataset for CDS BAX-like of Organism Anser cygnoid

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9EM33_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Anser cygnoid GN=BAK1 (length=663 residues).
atggggaacgacggagacccaccgggggcccacggacgccggggcagcaatgggcgcaggctgtcacaagagctcaattc
agaagaccaggtggcccaggagaccgaggaggtgtttcggagctacgccttctaccgctaccaacaggagagagaagaga
gtggggaagaagtgcccttggacccggagattgcagagatccagcaagagctgggcagcaccgggagcctggtggggagg
cgcctggccatcatcggcgatgacattaacaagcggtacgacgccgagtttcgctacatgctgaaatccttgcagcccac
caaggagaatgcctacgagtacttcaccacgatcgcctccagcctgttcgaaagcggcattaactggggccgggtgatcg
cgctgctgggcttcggctactgcatggccatccacgtctaccagcacggcataacgggcttcctccgccgcatcgcccgc
ttcgtgacggagttcatgctgcgcaaccgcatcgcccagtggatcgcccagcaaggaggatgggtgacgtggggcagagt
ggctgcactcgatctggacaatgtttacatgaagtacatgctggcggtggtggccctggtgatggtggggcatttagtgg
tacgacgcttcttcaggccctga
>gnl|bcl2dbcds|A0A8B9IHS5_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Anser cygnoid GN=BOK (length=642 residues).
atggaagtgcttcgccgatcctcagtcttcgctgcagaggtgatggaggtgttcgacaggtctcccactgacaaggagct
tgtgtcccaagctaaggccctctgcagagactacataaattcgaggctggttcgagcaggtgtcagctggagcaaacctg
acggcaatgcgccggtgcctggcggtaagctggccgaggtgtccaccatactgctgcggctgggagatgagctggaatac
attcgccccaacgtctaccggaatatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggacgcctt
cctggctgtagcggcgcagattttcaccgcaggcataacatggggcaaggtggtgtctctctacgcggtggcagcggggc
tggcggtggactgcgtgcggcacgcacagccagccatggttcacaccatcgtcgactgcctgggagagttcgtccgcaag
accttggtgacatggctgaaaaggcgaggaggctgggcagacatcacgaagtgtgttgtgaatactgaccccagccttcg
ctcccactggctcgtggctgctgtttgcagctttgggcacttcctcaaggcgatcttcttcgtgctgctgcctgagagat
ga
© 1998-2023Legal notice