Dataset for CDS BMF of organism Salmo salar

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A1S3P5K4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo salar GN=BMF (length=585 residues).
atggacgatgaggaggatgatgtgtttgaaccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagaggctcaatcagcagccccagcagccagcacgcagcatagagatctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacatgttcaagtggtgagaatacccaacgtgactgactgcacagcacagc
taaagcccactgaacaggcctactgtactcagaggtctgctgagagagagactgagcagcagaagtggcttctttacggg
catccattgtgttcacgtctcagtgtcccttgtttgttttggctagtcagtgagcatgcattagcccagtgttctgacct
ctcattctacccccccaagacgtag
>gnl|bcl2dbcds|A0A1S3P5K4_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Salmo salar GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgaaccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctggga
gagcgaggggggatggagaggctcaatcagcagccccagcagccagcacgcagcatagagatctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacatgttcaagtgtatcaccgaaaccaaagaaacatgaggcccttgtgga
ggcgcctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggagagagcagggtggaggtga
>gnl|bcl2dbcds|A0A1S3SNN2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo salar GN=BMF (length=486 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagccca
gaccactcttctatggcaacgcaggctttcgattgcactttccagcgcggtttgagcaggttggagaccaggggcctcag
gagcagcatcagggggagcgagggaggatggaacggcttcaacagcagccagcgcaaagcatggaggtctgcattggaca
gaaactccaactcatcggagaccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggccca
tgtggtggcgcctggcctcagctctgttcaccctgctgtttgagcaggaggccattgctggaagggggagagcagggtgg
aggtga
© 1998-2020Legal notice