Dataset for CDS BMF of organism Larimichthys crocea

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0F8AD62_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Larimichthys crocea GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattccgggagataaagtgtgaaga
ccagggcacacagacacctggtcctgccctggcaccgtacaacggcatgcttccctgtggagtcgcggaggagcccagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacactttgagcttgttggcgatcaggaagcaaggcac
caagaaagcgaaggggagcaaaacaggatggagcagcttccacggcagcaacctgtggcccgcagtgtggaggcctgcat
tggccagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctgggcgcagctctgctcagccttctgtttgacagggggttcattgctggaggaggtggagcg
ggacggaggtga
© 1998-2020Legal notice