Dataset for CDS BIK of organism Heterocephalus glaber

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G5BM80_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Heterocephalus glaber GN=BIK (length=561 residues).
atgtcggaagcaagacccgtcaccagggacctgctcatggagaccctgctgtatgagccgctccctgggcctctgttggc
cacaggggccttggctgtgatgcatcccttcaggggagaggatctcagtcccccaggggacactgacctcgtgggctgcc
tggaaggcagcagcctgatggccctgcggctggcctgcattggtgatgagatggacctgcgtctccgggccccccgcctg
gcccagttgcccgggagggccgtgcacagcctggccatcacctacagccaaatggggctctggggtgtgctcagaagcct
gactcctggtctcaccagcctcagggacatgtggccctggggacacctagccccccacgcctgggtgtcccctggctggg
cctgcaggcagctgctgcctgtggtgctgttggtgctgctgctcgggatcctgcgcctcctgctgcagggaggcccggca
ggcaggcagggctggtccctgtcccctctgccaccactgccccccggggggccaccgcctggccagctttgttcttttta
a
© 1998-2020Legal notice