Dataset for CDS HRK of organism Equus asinus asinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4LTR5_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Equus asinus asinus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggacgcggcccccgggccgtgtgtgcgtgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggagcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcttggctgctcggcaggcggaacttgtag
© 1998-2022Legal notice