Dataset for CDS BAD of organism Equus asinus asinus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C4MYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus asinus asinus GN=BAD (length=618 residues).
atgttccagatcccagagtttgagcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctac
gggggactggccctcagacccggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaagggacc
gaggatgaagggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgc
actacgctacggccgcgagctccggaggatgagcgacgagttccagggctccttccaggtgagcgccggcgcggcgcgca
cgcccggacctgttctcccaggtcacctcccactgggctgtcccatccgagtcccagtgcacgtcgggactgacgtctca
ggacccctcccctcccacgggcctgtccccaagtcccagggcatgctgggatctgtagttccaggacccctcccctccca
ccggcctgtccccgagtcccagggcatgccgggatctgtagtccagaccgctccgtag
>gnl|bcl2dbcds|A0A8C4MYJ3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus asinus asinus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctac
gggggactggccctcagacccggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaagggacc
gaggatgaagggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgc
actacgctacggccgcgagctccggaggatgagcgacgagttccagggctccttccaggcacttcctcgcccgaagagcg
cgggcacggcgacgcagatgcggcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccctcccagtga
© 1998-2022Legal notice