Dataset for CDS BIK of organism Cebus capucinus imitator

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5QXZ1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cebus capucinus imitator GN=BIK (length=471 residues).
atgtctgaagaaagacccctctccattgacatcttgatggagaccctcctgtgtgagcagttcatggatcccctgaccat
ggaggttgtcggtggtgggagtgaccctgaagaggacctggaccctgtggaggacccgttggaatgcatggagaacagtg
acgcactggccctgcagctggcctgcatcgcggaccagatggatgtgagccttagggcccggaagctggcccagctctac
gaggtggccatgtacagcccgggtctcgctgtcacccttgaccagaccgacatcagggatgttctcggcggtattgtgga
cattttcgctaacttccaggaggacgtagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacagg
cagtgctgctggcattcctggcgctgctgctggcgacgttcagcgggggtctgcacctgctgctcaagtga
© 1998-2020Legal notice