Dataset for CDS BCL-2-like of organism Tarsius syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1U7UZD8_BCL2L10      atggccgacccgctggaggagcgtaccgcgcgg---ctgctggctgacta
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      atgtc---------------tcagagcaaccgggagctggtggttgactt
A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      tctctcctacaagctttcccagaaaggatacagctggagtcagtttagcg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      -cctggagtactgc---gcccggccgcccggcagccccgagcc---gcgg
A0A1U7T4L4_BCL2L1-      atgtggaagagaacaggactgaggcctcagaagggactgagtcggagatg
A0A1U7T4L4_BCL2L1-      atgtggaagagaacaggactgaggcctcagaagggactgagtcggagatg
A0A1U7UJF2_BCL2L2-      -tgtaggctataa----gctgagg---cagaaggg-ttatgtctgtggag
A0A1U7UJF2_BCL2L2-      -tgtaggctataa----gctgagg---cagaaggg-ttatgtctgtggag
                           * *   *        *   *    * *   *      * *   *  *

A0A1U7UZD8_BCL2L10      ccgtcctc-------gcccgaggccgccgtgctg----------------
A0A1U7T4L4_BCL2L1-      gagacccccagtgccgtcaatggcaacccatcct----------------
A0A1U7T4L4_BCL2L1-      gagacccccagtgccgtcaatggcaacccatcctggcacctggtggacag
A0A1U7UJF2_BCL2L2-      ccggccctggggagggccca--gcagccgacccg----------------
A0A1U7UJF2_BCL2L2-      ccggccctggggagggccca--gcagccgacccg----------------
                          * **         * *    **  **   *                  

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      ccccgcggtgaatggagccactggccacagcagcagtttggatgcccggg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      ---------------------cgctccacggccgccaggctgcggcag--
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      aggtgatccccatggcagctgtgaagcaagcgctgagggaggcaggcgat
A0A1U7UJF2_BCL2L2-      --------------------ctgcaccaagccatgcgggcagctggagat
A0A1U7UJF2_BCL2L2-      --------------------ctgcaccaagccatgcgggcagctggagat

A0A1U7UZD8_BCL2L10      ------------------cggcacgcctccttcttctcggc--cttcgtt
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      gagtttgaactgcggtaccggcgggcattcagtgacctgacgtcccagct
A0A1U7UJF2_BCL2L2-      gagttcgagacccgcttccggcgcacgttctctgatctggcggctcagct
A0A1U7UJF2_BCL2L2-      gagttcgagacccgcttccggcgcacgttctctgatctggcggctcagct

A0A1U7UZD8_BCL2L10      g---actaccccgggagccgcgtggacctgacg----gcgcggatggccg
A0A1U7T4L4_BCL2L1-      -------------gggacagcgtat---cagagttttgaacaggtagtga
A0A1U7T4L4_BCL2L1-      ccacatcaccccagggacagcgtat---cagagttttgaacaggtagtga
A0A1U7UJF2_BCL2L2-      gcatgtgaccccaggctcagcccag---caacgcttcacccaggtctctg
A0A1U7UJF2_BCL2L2-      gcatgtgaccccaggctcagcccag---caacgcttcacccaggtctctg
                                     **  * **           *       * * *     

A0A1U7UZD8_BCL2L10      atgccgtgctctctggcagccgcgacctcagctggggccgcgtggtgacg
A0A1U7T4L4_BCL2L1-      acgaactcttccggg------atggggtaaactggggtcgcatcgtggcc
A0A1U7T4L4_BCL2L1-      acgaactcttccggg------atggggtaaactggggtcgcatcgtggcc
A0A1U7UJF2_BCL2L2-      atgaacttttccaag------ggggccccaactggggccgccttgtggcc
A0A1U7UJF2_BCL2L2-      atgaacttttccaag------ggggccccaactggggccgccttgtggcc
                        * *   *  **   *        *     * ****** *** * *** * 

A0A1U7UZD8_BCL2L10      ctcgtgaccttcgcggggacgcttctggagcgaggaccgctgctgcccgc
A0A1U7T4L4_BCL2L1-      tttttctccttcggcggggcact-------------------gtgtgtgg
A0A1U7T4L4_BCL2L1-      tttttctccttcggcggggcact-------------------gtgtgtgg
A0A1U7UJF2_BCL2L2-      ttctttgtctttggggctgcact-------------------ctgtgctg
A0A1U7UJF2_BCL2L2-      ttctttgtctttggggctgcact-------------------ctgtgctg
                         *  *   *** *  *   * **                    **     

A0A1U7UZD8_BCL2L10      cggggggcagcagcggggcttcaggccccggcggaagaaggaggagggcg
A0A1U7T4L4_BCL2L1-      agagcgtagacaa-ggagatgcaggtattggtgagtcggatcgcaacttg
A0A1U7T4L4_BCL2L1-      agagcgtagacaa-ggagatgcaggtattggtgagtcggatcgcaacttg
A0A1U7UJF2_BCL2L2-      aaagtgtcaacaa-ggagatggagccactggtgggacaagtgcaggagtg
A0A1U7UJF2_BCL2L2-      aaagtgtcaacaa-ggagatggagccactggtgggacaagtgcaggagtg
                           * *    **  ** * *  **     ** *                *

A0A1U7UZD8_BCL2L10      acgttgcgcgggactgccagcgcctggtggccttgctgagcgcgcggctc
A0A1U7T4L4_BCL2L1-      g----------------------atggccacttacctgaatgaccaccta
A0A1U7T4L4_BCL2L1-      g----------------------atggccacttacctgaatgaccaccta
A0A1U7UJF2_BCL2L2-      g----------------------atggtggcctacctggagacgcggctg
A0A1U7UJF2_BCL2L2-      g----------------------atggtggcctacctggagacgcggctg
                                                ***   * *  ***      *  ** 

A0A1U7UZD8_BCL2L10      gcggggcggcaccgcgcctggctgcaggctcaaggcggctgggat-----
A0A1U7T4L4_BCL2L1-      ga------------gccttggatccaggacaacggcggctgggac-----
A0A1U7T4L4_BCL2L1-      ga------------gccttggatccaggacaacggcggctgggac-----
A0A1U7UJF2_BCL2L2-      gc------------cgactggatccacagcagtgggggctgggagctgga
A0A1U7UJF2_BCL2L2-      gc------------cgactggatccacagcagtgggggctgggcg-----
                        *                 *** * **       ** *******       

A0A1U7UZD8_BCL2L10      -ggcttttgtgtcttcttcag----------------tacaccctta---
A0A1U7T4L4_BCL2L1-      -acttttgtggaactctacgggaacaatgcagcagctgagagccggaagg
A0A1U7T4L4_BCL2L1-      -acttttgtggaactctacgggaacaatgcagcagctgagagccggaagg
A0A1U7UJF2_BCL2L2-      agcgatcaaagcccgagtcagggagatgga---gg--aggaagctgaaaa
A0A1U7UJF2_BCL2L2-      -gagttcacagctctatacggggacggggccctgg--aggaggcgcggcg
                             *    *       * *                   *  *      

A0A1U7UZD8_BCL2L10      -ccactaactttttg----------gagaag-------------------
A0A1U7T4L4_BCL2L1-      gccaggagcgcttca-----------------------------------
A0A1U7T4L4_BCL2L1-      gccaggagcgcttca-----------------------------------
A0A1U7UJF2_BCL2L2-      gctaaaagagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A1U7UJF2_BCL2L2-      tctgcgggag---------------gggaactgggcatcagtgag-----

A0A1U7UZD8_BCL2L10      --------actgccggttcaggc---------------------------
A0A1U7T4L4_BCL2L1-      --------accgctggttc-------------------------------
A0A1U7T4L4_BCL2L1-      --------accgctggttc-------------------------------
A0A1U7UJF2_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggaaaagatggag
A0A1U7UJF2_BCL2L2-      -----gacagtgctgac-----------------------------ggga
                                *  ** *                                   

A0A1U7UZD8_BCL2L10      ----------------------------gtttgtgtcatg----------
A0A1U7T4L4_BCL2L1-      ----------------------------ctgacgggcatg----------
A0A1U7T4L4_BCL2L1-      ----------------------------ctgacgggcatg----------
A0A1U7UJF2_BCL2L2-      gctgatgctcgttccatctatgttggcaatgtggactatggtgcaacagc
A0A1U7UJF2_BCL2L2-      gccg-------------------tggcactgggggccctggt--------
                                                     *        **          

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      agaagagctagaagctcactttcatggctgtggttcagtcaaccgtgtta
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      --------------ccttttagcaatggccttcatctattttttct----
A0A1U7T4L4_BCL2L1-      ---------------accgtagc--tggcgt------ggttctgct----
A0A1U7T4L4_BCL2L1-      ---------------accgtagc--tggcgt------ggttctgct----
A0A1U7UJF2_BCL2L2-      ccatactctgtgacaaatttagt--ggccatcccaaaggttttgcttata
A0A1U7UJF2_BCL2L2-      --------------aactgtagg--ggcctt--------ttttgct----
                                           ***    * * *        ** * **    

A0A1U7UZD8_BCL2L10      --ggacacgattatta--------tga-----------------------
A0A1U7T4L4_BCL2L1-      --gggctcgctcttcagtcggaaatga-----------------------
A0A1U7T4L4_BCL2L1-      --gggctcgctcttcagtcggaaatga-----------------------
A0A1U7UJF2_BCL2L2-      tagagttctcagacaaagagtcagtgaggacttccctggccttagatgag
A0A1U7UJF2_BCL2L2-      ------------------agcaagtga-----------------------

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      tccctatttagaggaagacaaatcaaggtgatcccaaaacgaaccaacag
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      accaggcatcagcacaacagaccggggtttcccacgagcccgctaccgtg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      cccggaccaccaattacaacagttcccgctctcgattctacagtggtttt
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      aacagcaggcctcggggtcgcgtctacaggggccgggctagagcgacatc
A0A1U7UJF2_BCL2L2-      --------------------------------------------------

A0A1U7UZD8_BCL2L10      -------------------
A0A1U7T4L4_BCL2L1-      -------------------
A0A1U7T4L4_BCL2L1-      -------------------
A0A1U7UJF2_BCL2L2-      atggtattccccttactaa
A0A1U7UJF2_BCL2L2-      -------------------

© 1998-2020Legal notice