Dataset for CDS BCL2L2 of organism Tarsius syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
                        **************************************************

A0A1U7UJF2_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagccggccctg
A0A1U7UJF2_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagccggccctg
                        **************************************************

A0A1U7UJF2_BCL2L2-      gggagggcccagcagccgacccgctgcaccaagccatgcgggcagctgga
A0A1U7UJF2_BCL2L2-      gggagggcccagcagccgacccgctgcaccaagccatgcgggcagctgga
                        **************************************************

A0A1U7UJF2_BCL2L2-      gatgagttcgagacccgcttccggcgcacgttctctgatctggcggctca
A0A1U7UJF2_BCL2L2-      gatgagttcgagacccgcttccggcgcacgttctctgatctggcggctca
                        **************************************************

A0A1U7UJF2_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
A0A1U7UJF2_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
                        **************************************************

A0A1U7UJF2_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtggccttcttt
A0A1U7UJF2_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtggccttcttt
                        **************************************************

A0A1U7UJF2_BCL2L2-      gtctttggggctgcactctgtgctgaaagtgtcaacaaggagatggagcc
A0A1U7UJF2_BCL2L2-      gtctttggggctgcactctgtgctgaaagtgtcaacaaggagatggagcc
                        **************************************************

A0A1U7UJF2_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A1U7UJF2_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                        **************************************************

A0A1U7UJF2_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
A0A1U7UJF2_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
                        ********************************* *      * * *** *

A0A1U7UJF2_BCL2L2-      gcccgagtcagggagatgga---ggaggaagctgaaaagctaaaagagct
A0A1U7UJF2_BCL2L2-      gctctatacggggacggggccctggaggaggcgcggcgtctgcgggag--
                        ** * *  * ****   **    ****** **       **    ***  

A0A1U7UJF2_BCL2L2-      acagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatg
A0A1U7UJF2_BCL2L2-      -------------gggaactgggcatcagtgag----------gacagtg
                                     * ***   *       ****          * ** **

A0A1U7UJF2_BCL2L2-      ctggcccagtgatcatgtccattgaggaaaagatggaggctgatgctcgt
A0A1U7UJF2_BCL2L2-      ctgac-----------------------------gggagccg--------
                        *** *                             **  ** *        

A0A1U7UJF2_BCL2L2-      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctaga
A0A1U7UJF2_BCL2L2-      -----------tggcactgggggccctggt--------------------
                                   ***** ** ** *  ****                    

A0A1U7UJF2_BCL2L2-      agctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7UJF2_BCL2L2-      acaaatttagtggccatcccaaaggttttgcttatatagagttctcagac
A0A1U7UJF2_BCL2L2-      --aactgtaggggcctt--------ttttgct------------------
                          ** * *** **** *        *******                  

A0A1U7UJF2_BCL2L2-      aaagagtcagtgaggacttccctggccttagatgagtccctatttagagg
A0A1U7UJF2_BCL2L2-      ----agcaagtga-------------------------------------
                            **  *****                                     

A0A1U7UJF2_BCL2L2-      aagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7UJF2_BCL2L2-      caacagaccggggtttcccacgagcccgctaccgtgcccggaccaccaat
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7UJF2_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggcctcg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7UJF2_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7UJF2_BCL2L2-      actaa
A0A1U7UJF2_BCL2L2-      -----
                             

© 1998-2020Legal notice