Dataset for CDS BCL2L1 of organism Tarsius syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1U7T4L4_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A1U7T4L4_BCL2L1-      --------------------------------------------------

A0A1U7T4L4_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagcgatgtggaagagaaca
A0A1U7T4L4_BCL2L1-      -----------------------------------atgtggaagagaaca

A0A1U7T4L4_BCL2L1-      ggactgaggcctcagaagggactgagtcggagatggagacccccagtgcc
A0A1U7T4L4_BCL2L1-      ggactgaggcctcagaagggactgagtcggagatggagacccccagtgcc

A0A1U7T4L4_BCL2L1-      gtcaatggcaacccatcctggcacctggtggacagccccgcggtgaatgg
A0A1U7T4L4_BCL2L1-      gtcaatggcaacccatcct-------------------------------

A0A1U7T4L4_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A1U7T4L4_BCL2L1-      --------------------------------------------------

A0A1U7T4L4_BCL2L1-      cagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcgg
A0A1U7T4L4_BCL2L1-      --------------------------------------------------

A0A1U7T4L4_BCL2L1-      taccggcgggcattcagtgacctgacgtcccagctccacatcaccccagg
A0A1U7T4L4_BCL2L1-      ------------------------------------------------gg

A0A1U7T4L4_BCL2L1-      gacagcgtatcagagttttgaacaggtagtgaacgaactcttccgggatg
A0A1U7T4L4_BCL2L1-      gacagcgtatcagagttttgaacaggtagtgaacgaactcttccgggatg

A0A1U7T4L4_BCL2L1-      gggtaaactggggtcgcatcgtggcctttttctccttcggcggggcactg
A0A1U7T4L4_BCL2L1-      gggtaaactggggtcgcatcgtggcctttttctccttcggcggggcactg

A0A1U7T4L4_BCL2L1-      tgtgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A1U7T4L4_BCL2L1-      tgtgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc

A0A1U7T4L4_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A1U7T4L4_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg

A0A1U7T4L4_BCL2L1-      acaacggcggctgggacacttttgtggaactctacgggaacaatgcagca
A0A1U7T4L4_BCL2L1-      acaacggcggctgggacacttttgtggaactctacgggaacaatgcagca

A0A1U7T4L4_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
A0A1U7T4L4_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg

A0A1U7T4L4_BCL2L1-      catgaccgtagctggcgtggttctgctgggctcgctcttcagtcggaaat
A0A1U7T4L4_BCL2L1-      catgaccgtagctggcgtggttctgctgggctcgctcttcagtcggaaat

A0A1U7T4L4_BCL2L1-      ga
A0A1U7T4L4_BCL2L1-      ga

© 1998-2020Legal notice