Dataset for CDS BCL2L2 of organism Mesocricetus auratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U7RC37_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggctgactt
A0A1U7RC37_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctagtggctgactt
                        **************************************************

A0A1U7RC37_BCL2L2-      tgtaggctataagctgaggcagaagggctatgtctgtggagctggccctg
A0A1U7RC37_BCL2L2-      tgtaggctataagctgaggcagaagggctatgtctgtggagctggccctg
                        **************************************************

A0A1U7RC37_BCL2L2-      gggagggcccagcagccgacccgctgcaccaagccatgcgggctgctgga
A0A1U7RC37_BCL2L2-      gggagggcccagcagccgacccgctgcaccaagccatgcgggctgctgga
                        **************************************************

A0A1U7RC37_BCL2L2-      gacgagtttgagacccgcttccggcgcaccttctccgacctggctgctca
A0A1U7RC37_BCL2L2-      gacgagtttgagacccgcttccggcgcaccttctccgacctggctgctca
                        **************************************************

A0A1U7RC37_BCL2L2-      gctccacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
A0A1U7RC37_BCL2L2-      gctccacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
                        **************************************************

A0A1U7RC37_BCL2L2-      acgaacttttccaagggggccccaattggggccgtcttgtggcattcttt
A0A1U7RC37_BCL2L2-      acgaacttttccaagggggccccaattggggccgtcttgtggcattcttt
                        **************************************************

A0A1U7RC37_BCL2L2-      gtctttggggccgccctatgtgctgaaagtgtcaacaaagaaatggagcc
A0A1U7RC37_BCL2L2-      gtctttggggccgccctatgtgctgaaagtgtcaacaaagaaatggagcc
                        **************************************************

A0A1U7RC37_BCL2L2-      acttgtgggacaagtgcaggattggatggtgacttacctggagacacgcc
A0A1U7RC37_BCL2L2-      acttgtgggacaagtgcaggattggatggtgacttacctggagacacgcc
                        **************************************************

A0A1U7RC37_BCL2L2-      tggctgactggatccacagcagtggcggctgggagctagaagcgatcaaa
A0A1U7RC37_BCL2L2-      tggctgactggatccacagcagtggcggctgggcg------gagttcaca
                        ********************************* *      * * *** *

A0A1U7RC37_BCL2L2-      gcccgagtcagggagatgga---ggaggaggctgagaagctaaaggagct
A0A1U7RC37_BCL2L2-      gctctgtacggggacggggccctggaggaggcgcggcgtctgcgggag--
                        ** *    * ****   **    *********   *   **   ****  

A0A1U7RC37_BCL2L2-      acaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatg
A0A1U7RC37_BCL2L2-      -------------gggaactgggcctcagtgag----------gacagtg
                                     * ***   *       ****          * ** **

A0A1U7RC37_BCL2L2-      ctggcccagtgatcatgtctcttgaggagaagatggaggctgatgcccgt
A0A1U7RC37_BCL2L2-      ctgac-----------------------------gggggccg--------
                        *** *                             ** *** *        

A0A1U7RC37_BCL2L2-      tctatctatgttggcaatgtggactatggtgcgacagcagaagagctgga
A0A1U7RC37_BCL2L2-      -----------tggcactgggggccctggt-------------aactgta
                                   ***** ** ** *  ****             * *** *

A0A1U7RC37_BCL2L2-      agcccactttcatggctgtggttcagtcaaccgtgtcactatactctgtg
A0A1U7RC37_BCL2L2-      gg------------------------------------------------
                         *                                                

A0A1U7RC37_BCL2L2-      acaaatttagcggccatcctaaagggtttgcatatatagagttctcagac
A0A1U7RC37_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7RC37_BCL2L2-      aaagagtcggtgaggacttccctggccttagacgagtccctgtttagagg
A0A1U7RC37_BCL2L2-      -----------------------ggcctt---------------------
                                               ******                     

A0A1U7RC37_BCL2L2-      aagacaaatcaaggtgattcccaaacggaccaacagaccaggcatcagta
A0A1U7RC37_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7RC37_BCL2L2-      caacagaccggggtttcccgcgtgcccgataccgtgcccggactaccaat
A0A1U7RC37_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7RC37_BCL2L2-      tacaacagctcccgatctcgattctacagcggttttaacagcaggccccg
A0A1U7RC37_BCL2L2-      --------------------------------ttttgctagcaag-----
                                                        ****   **** *     

A0A1U7RC37_BCL2L2-      gggtcgagtctacaggggccgggctagagcgacatcatggtattcccctt
A0A1U7RC37_BCL2L2-      --------------------------------------------------
                                                                          

A0A1U7RC37_BCL2L2-      actaa
A0A1U7RC37_BCL2L2-      --tga
                          * *

© 1998-2020Legal notice