Dataset for CDS BCL-2-like of organism Lonchura striata domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A218V8Z6_BCL2A1-      atg-------------------------gaaactg-----ctgagttcta
A0A218UQA0_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A218USB3_BCL2L1-      atg------------------tacagcagtaaccgggagttagtgattga
A0A218USB3_BCL2L1-      atg------------------tacagcagtaaccgggagttagtgattga
A0A218USB3_BCL2L1-      atg------------------tacagcagtaaccgggagttagtgattga
A0A218USB3_BCL2L1-      atg------------------tacagcagtaaccgggagttagtgattga
                        ***                           *** *       * * *  *

A0A218V8Z6_BCL2A1-      ttacgtttattac-------------------------------------
A0A218UQA0_BCL2-01      gtacatccactataaactctctcagaggggatacgactggg--ctgccgg
A0A218USB3_BCL2L1-      ctttgtttcctacaagctctcacagaaaggatacagctggagtcagctgg
A0A218USB3_BCL2L1-      ctttgtttcctacaagctctcacagaaaggatacagctggagtcagctgg
A0A218USB3_BCL2L1-      ctttgtttcctacaagctctcacagaaaggatacagctggagtcagctgg
A0A218USB3_BCL2L1-      ctttgtttcctacaagctctcacagaaaggatacagctggagtcagctgg
                         *   *    **                                      

A0A218V8Z6_BCL2A1-      ----------ttagcccagg------------------------------
A0A218UQA0_BCL2-01      ----------tgaggacagggtatccctgcctccagatcactccgcttct
A0A218USB3_BCL2L1-      aagaggaggatgagaacagg------------------------------
A0A218USB3_BCL2L1-      aagaggaggatgagaacagg------------------------------
A0A218USB3_BCL2L1-      aagaggaggatgagaacagg------------------------------
A0A218USB3_BCL2L1-      aagaggaggatgagaacagg------------------------------
                                  * **  ****                              

A0A218V8Z6_BCL2A1-      acta--tctgcagtatgtgctccaggaa----------------------
A0A218UQA0_BCL2-01      gctgctgctgcgattgctgctgctgggacttctgatcacactgggctggt
A0A218USB3_BCL2L1-      actgactttgcaggggaggaggacgaga-------------tggacgggg
A0A218USB3_BCL2L1-      actgactttgcaggggaggaggacgaga-------------tggacgggg
A0A218USB3_BCL2L1-      actgactttgcaggggaggaggacgaga-------------tggacgggg
A0A218USB3_BCL2L1-      actgactttgcaggggaggaggacgaga-------------tggacgggg
                         **     ***       *     *  *                      

A0A218V8Z6_BCL2A1-      ----tcacacctcggaccagcccagacccgg--gttgct-----cat---
A0A218UQA0_BCL2-01      gtctccgcaccccgagccc--cccggctcggctactgctagccacac---
A0A218USB3_BCL2L1-      ---tcctcaacgggagcccctcctggcac-gcggccaccagccacatagt
A0A218USB3_BCL2L1-      ---tcctcaacgggagcccctcctggcac-gcggccaccagccacatagt
A0A218USB3_BCL2L1-      ---tcctcaacgggagcccctcctggcac-gcggccaccagccacatagt
A0A218USB3_BCL2L1-      ---tcctcaacgggagcccctcctggcac-gcggccaccagccacatagt
                             * ** *  *  **   ** * * * *      *      **    

A0A218V8Z6_BCL2A1-      ----------------------------gtcttgagaaccatggcatcc-
A0A218UQA0_BCL2-01      -------gcccccg-gcagaggggctgcgccctgcaccccaggtcgtcca
A0A218USB3_BCL2L1-      gaatggagccactgtgcaccagagc--agcctcgaagtccatgagatccg
A0A218USB3_BCL2L1-      gaatggagccactgtgcaccagagc--agcctcgaagtccatgagatccg
A0A218USB3_BCL2L1-      gaatggagccactgtgcaccagagc--agcctcgaagtccatgagatccg
A0A218USB3_BCL2L1-      gaatggagccactgtgcaccagagc--agcctcgaagtccatgagatccg
                                                    * *  *    *** *   *** 

A0A218V8Z6_BCL2A1-      --------tctctgcaagaccaaacg------------gagga-------
A0A218UQA0_BCL2-01      cc------tcgtcctgcg-ccaggcg------------ggggatgagttc
A0A218USB3_BCL2L1-      tcgagcagccgatgtgag-gcaggcgctgagagaggcaggggatgagttt
A0A218USB3_BCL2L1-      tcgagcagccgatgtgag-gcaggcgctgagagaggcaggggatgagttt
A0A218USB3_BCL2L1-      tcgagcagccgatgtgag-gcaggcgctgagagaggcaggggatgagttt
A0A218USB3_BCL2L1-      tcgagcagccgatgtgag-gcaggcgctgagagaggcaggggatgagttt
                                 *       *  **  **            * ***       

A0A218V8Z6_BCL2A1-      -----------------ggctgtcaggccactcctggacaggattgacat
A0A218UQA0_BCL2-01      tcccgacgctaccagagggacttttcccaaatgtctggccagctgcacct
A0A218USB3_BCL2L1-      gagctgaggtaccggcgggcgttcagcgacctcacttcccagctccacat
A0A218USB3_BCL2L1-      gagctgaggtaccggcgggcgttcagcgacctcacttcccagctccacat
A0A218USB3_BCL2L1-      gagctgaggtaccggcgggcgttcagcgacctcacttcccagctccacat
A0A218USB3_BCL2L1-      gagctgaggtaccggcgggcgttcagcgacctcacttcccagctccacat
                                         **   *        *      *  * *  ** *

A0A218V8Z6_BCL2A1-      cagctctgtagctgttgccaagagaattttcaatggagtcatggatgaaa
A0A218UQA0_BCL2-01      gacgcccttcac---ggccaggagccgcttcgtggcggtggtggaggagc
A0A218USB3_BCL2L1-      cactcccagcac---agcgtatcagagctttgagcaggtagtgaacgaac
A0A218USB3_BCL2L1-      cactcccagcac---agcgtatcagagctttgagcaggtagtgaacgaac
A0A218USB3_BCL2L1-      cactcccagcac---agcgtatcagagctttgagcaggtagtgaacgaac
A0A218USB3_BCL2L1-      cactcccagcac---agcgtatcagagctttgagcaggtagtgaacgaac
                         *   *     *    **          **       **  ** * **  

A0A218V8Z6_BCL2A1-      agtttgctgatggaaatactaactggggacgaattatgaccatctttacg
A0A218UQA0_BCL2-01      tcttccgagatggg---gttaactggggcagaattgtggccttcttcgag
A0A218USB3_BCL2L1-      tgttccgcgatgga---gtgaactggggccgcatcgtggctttcttctcc
A0A218USB3_BCL2L1-      tgttccgcgatgga---gtgaactggggccgcatcgtggctttcttctcc
A0A218USB3_BCL2L1-      tgttccgcgatgga---gtgaactggggccgcatcgtggctttcttctcc
A0A218USB3_BCL2L1-      tgttccgcgatgga---gtgaactggggccgcatcgtggctttcttctcc
                          **    *****       ********  * **  ** *  ****    

A0A218V8Z6_BCL2A1-      tttggaggtcttctcaccaagaagcttcaagagcatggggttcagctgac
A0A218UQA0_BCL2-01      tttggcggtgtgat-------gtgtgtggagagcgt--caaccgggagat
A0A218USB3_BCL2L1-      ttcggaggagcctt-------gtgcgtggagagcgt--tgttaaggagat
A0A218USB3_BCL2L1-      ttcggaggagcctt-------gtgcgtggagagcgt--tgttaaggagat
A0A218USB3_BCL2L1-      ttcggaggagcctt-------gtgcgtggagagcgt--tgttaaggagat
A0A218USB3_BCL2L1-      ttcggaggagcctt-------gtgcgtggagagcgt--tgttaaggagat
                        ** ** **     *         *  *  ***** *        *  ** 

A0A218V8Z6_BCL2A1-      tgcagaagagaaggaggagatctcttatttcatcacagagtacatcataa
A0A218UQA0_BCL2-01      gtttcccctcgtggacaacattgccacctggatgactgagtacctgaacc
A0A218USB3_BCL2L1-      gagggtattggtgaaacgcatcgtgtcttggatgaccacgtacttgaccg
A0A218USB3_BCL2L1-      gagggtattggtgaaacgcatcgtgtcttggatgaccacgtacttgaccg
A0A218USB3_BCL2L1-      gagggtattggtgaaacgcatcgtgtcttggatgaccacgtacttgaccg
A0A218USB3_BCL2L1-      gagggtattggtgaaacgcatcgtgtcttggatgaccacgtacttgaccg
                                    * *    **       *  ** **   **** * *   

A0A218V8Z6_BCL2A1-      acaacaaagccgaatggattgatgcaaatggtggctgggaaaatggcttc
A0A218UQA0_BCL2-01      ggcacctgcacaactggatccaggacaacggaggctggg---atgccttt
A0A218USB3_BCL2L1-      accacttggatccctggatccaggagaatggcggatggg---agcgcttt
A0A218USB3_BCL2L1-      accacttggatccctggatccaggagaatggcggatggg---agcgcttt
A0A218USB3_BCL2L1-      accacttggatccctggatccaggagaatggcggatggg---agcgcttt
A0A218USB3_BCL2L1-      accacttggatccctggatccaggagaatggcggatggg---agcgcttt
                           **         *****  * *  ** ** ** ****   *   *** 

A0A218V8Z6_BCL2A1-      ct--aactaagtttgaa-----------------------------agaa
A0A218UQA0_BCL2-01      gtggagttgtatggcaacaat-------------------------atga
A0A218USB3_BCL2L1-      gtggacctctatgggaacgatgctgctgccgagatgagaaaaggccagga
A0A218USB3_BCL2L1-      gtggacctctatgggaacgatgctgctgccgagatgagaaaaggccagga
A0A218USB3_BCL2L1-      gtggacctctatgggaacgatgctgctgccgagatgagaaaaggccagga
A0A218USB3_BCL2L1-      gtggacctctatgggaacgatgctgctgccgagatgagaaaaggccagga
                         *  *  *   *   **                             *  *

A0A218V8Z6_BCL2A1-      gatcactactgtccttctccagaattacagccctgttcatagcccttgtt
A0A218UQA0_BCL2-01      ggcctttgtttgatttctcctggatctctctgaagac--tatcctgagtc
A0A218USB3_BCL2L1-      gaccttcaacaaatggctcctga----ccggggcgacggtggccggag--
A0A218USB3_BCL2L1-      gaccttcaacaaatggctcctga----ccggggcgacggtggccggag--
A0A218USB3_BCL2L1-      gaccttcaacaaatggctcctga----ccggggcgacggtggccggag--
A0A218USB3_BCL2L1-      gaccttcaacaaatggctcctga----ccggggcgacggtggccggag--
                        *  *            **** *     *      *    *  **   *  

A0A218V8Z6_BCL2A1-      tccttgttca----------------------------------------
A0A218UQA0_BCL2-01      tggttctggt----------------------------------------
A0A218USB3_BCL2L1-      tgcttctgctgagcacggactcgtgctgctcatgtcggacccgctcagac
A0A218USB3_BCL2L1-      tgcttctgct----------------------------------------
A0A218USB3_BCL2L1-      tgcttctgct----------------------------------------
A0A218USB3_BCL2L1-      tgcttctgct----------------------------------------
                        *  ** *                                           

A0A218V8Z6_BCL2A1-      ----------gagagt---------------actactga-----------
A0A218UQA0_BCL2-01      ----------gggagcttgcatcactcttggc--gcttatc---------
A0A218USB3_BCL2L1-      cccgcatggggagcacgaggattagcattagcccattga-----------
A0A218USB3_BCL2L1-      ----------gagcacgaggattagcattagcccattgaacgcttcggtt
A0A218USB3_BCL2L1-      ----------g-------ggatc--------cctgctgagc---------
A0A218USB3_BCL2L1-      ----------g-------ggatc--------cctgctgagc---------
                                  *                         * *           

A0A218V8Z6_BCL2A1-      ---------------
A0A218UQA0_BCL2-01      -ttggacataagtag
A0A218USB3_BCL2L1-      ---------------
A0A218USB3_BCL2L1-      tgcaggtggaggtga
A0A218USB3_BCL2L1-      ------cgcaagtga
A0A218USB3_BCL2L1-      ------cgcaagtga
                                       

© 1998-2020Legal notice